Arid4b (NM_194262) Mouse Untagged Clone

CAT#: MC224223

Arid4b (untagged) - Mouse AT rich interactive domain 4B (RBP1-like) (Arid4b), transcript variant 1, (10ug)

  View "NM_194262" in other vectors (6)

USD 1,730.00


Availability*
7 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Arid4b (NM_194262) Mouse Untagged Clone
Symbol Arid4b
Synonyms BCAA; BRCAA1; RBBP1L1; Rbp1l1; SAP180
Vector pCMV6-Entry
Sequence Data
>MC224223 representing NM_194262
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGGCCCTTGATGAACCTCCTTATTTGACAGTGGGCACTGATGTGAGTGCCAAATACAGAGGAGCCT
TCTGTGAAGCCAAGATCAAGACTGCAAAAAGACTTGTCAAAGTCAAGGTGACTTTTAGACACGATTCTTC
AACAGTGGAAGTTCAGGATGACCACATAAAGGGCCCACTGAAGGTAGGAGCTATTGTGGAAGTGAAGAAT
CTTGATGGTGCCTATCAGGAAGCGGTTATCAATAAACTGACAGATGCAAGTTGGTATACTGTGGTTTTTG
ATGATGGAGATGAGAAGACACTGAGAAGATCTTCATTATGTCTGAAAGGAGAGAGACATTTTGCTGAAAG
TGAAACACTAGACCAGCTCCCACTCACCAATCCTGAGCATTTTGGCACTCCAGTCATAGGAAAGAAAACA
AATAGAGGAAGAAGATCTAACCATATACCAGAGGAGGAGTCTTCCTCCTCATCCAGTGATGACGATGAGG
AGGAGAGGAAACAGACTGATGAGCTACTAGGCAAAGTTGTTTGTGTAGATTATGTTAGCTTGGAGAAAAA
GAAAGCGATGTGGTTTCCTGCACTGGTGGTTTGTCCTGACTGTAGTGATGAGATTGCTGTGAAAAAAGAC
AATATTCTTGTTCGGTCTTTCAAAGATGGCAAATTTACTTCAGTTCCAAGAAAAGATGTCCATGAAATTA
CTAGTGACACTGTACCGAAGCCTGATGCTGTATTAAAACAAGCCTTTGATCAGGCACTTGAGTTTCACAA
AAGTAGAGCTATTCCTGCTAATTGGAAGACTGAATTGAAAGAAGACAGCTCCAGTAGTGAAGCTGAGGAG
GAGGAGGAGGAGGAAGATGATGAAAAAGAGAAAGAAGATAACAGCAGCGAAGAAGAGGAAGAAATAGAAC
CATTTCCAGAGGAAAGGGAGAACTTTCTTCAGCAGCTGTATAAGTTCATGGAGGATAGAGGTACACCTAT
TAACAAACGGCCTGTGCTTGGGTATCGAAATTTGAATCTTTTTAAGTTATTCAGACTTGTGCACAAACTT
GGAGGGTTTGATAATATTGAAAGTGGAGCTGTTTGGAAGCAAGTCTATCAAGACCTTGGGATCCCTGTCT
TAAATTCAGCTGCAGGATACAATGTTAAATGTGCTTATAAAAAGTACTTATATGGCTTTGAGGAGTACTG
CAGGTCGGCTAATATTGACTTTCAGATGGCATTGCCAGAGAAAGTTCTTAACAAGCCATGTAAAGATTGT
GAAAATAAAGAAGTAAAAGTTAAGGAAGAAAGTGAAACAGAGATTAAAGAAGTAAATGTGGAAGACAGTA
AGAACGTGATGCCAAAAGAGGAGACGCCTGCTGAGGATGAAAGTGAAAGAAAAGAAAATATCAAGCCCTC
TCTGGGAAGTAAAAAAAGCTTATTAGAATGTATACCTGCACAATCTGATGAAGAAAAAGAAGCTCACATT
ACAAAACTCGAAGAAAATGAAAACTTGGAAGATAAAGACGGTGGCAGAGCTAGGACCGAGGAGGCCTTCA
GCACAGAGGTAGATGGTGAAGAAGAGCAAGCACGATCTGGAGATGAAACCAATAAAGAAGAAGATGAAGA
TGATGAAGAAATAGAAGAGGAGGAGGAAGAAGACGAGGAAGAAGACGAGGATGAAGATGATGATGACAAC
AATGAAGAAGAGGAGTTTGAGTGCTATCCACCAGGCATGAAAGTCCAAGTGCGGTATGGACGAGGGAAAA
ATCAAAAAATGTATGAAGCTAGTATAAAAGATTCTGATGTCGAAGGTGGAGAGGCCCTTTACTTGGTGCA
TTACTGCGGATGGAATGTGAGATATGATGAATGGATTAAAGCAGATAAAATAGTAAGACCTGCTGATAAA
AATGTACCAAAGATCAAACATCGGAAGAAAATAAAGAATAAACTAGACAAAGAAAAAGACAGAGATGAAA
AATACTCTCCTAAGAACTGTAAACTTCGACGCTTGTCAAAATCACCGTTTCAGTCAAATCCATCTCCTGA
GATGGTTTCCAAACTAGATCTTGCTGATGCCAAAAACTCTGATACAGCTCATATTAAATCTATAGAAATT
ACTTCCATTCTTAATGGACTACAAGCTTCTGAAAGTTCGGCTGAAGACAGTGAGCAGGAAGATGAGAGAT
GTACTCAGGACGTAGATAACATTGGCAAAGACGAATCAAAGGTGGAACATTCAACCCACAGCAGAAATGA
ACTGATTTCAAAAGAGGAACAGAGTAGTCCATCTTTGCTAGAAGAAAACAAAGTCCATACAGATTTGGTA
ATAGCCAAAACAGTGTCAAAATCTCCAGAAAGATTAAGAAAAGATATGGAAGCAATATCGGAAGATACTG
ATTTTGAAGAGGAAGATGAAATCACAAAGAAGAGAAAGGATGTTAAAAAGGACACAACAGACAAGGCTTT
AAAGCCACAAACAAAACGTGGGAAAAGACGGTATTGCAGTGCAGATGAATGTTTGCAGACTGGATCCCCT
GGCAAGAAGGAAGACAGAACCAAGAGTAAAGAGCCGCTCTGCACAGAAAACAGTAGTAACAGCTCCTCAG
ATGAAGATGAAGAAGAAAAGTCCAAAGCAAAGATGACACCAACCAAGAAATATAATGGCTTAGAAGAAAA
GAGAAAATCTCTGCGGACAACTAGTTTCTATTCAGGATTTTCAGAAGTAGCAGAAAAAAGGATAAAGCTT
TTAAATAACTCTGATGAAAGACTTCAGAACAACAGGGCTAAAGATAGAAAAGATGTCTGGTCAAGTATTC
AGGGACAGTGGCCTAAGAAAACGCTAAAGGAGCTTTTCTCTGACTCGGACACTGAGGCTGCAGCTTCTCC
ACCCCATCCTGCCCCAGATGAGGGGGCAGTAGAGGAGTCACTGCAGACTGTGGCAGAAGAGGAGAGTTGT
TCACCCATTATGGAGCTAGAAAAGCCACTACCTGCCAGTGTTGACAATAAGCCCATTGAAGAAAAACCCC
TAGAAGTTAGTGATAGGAAAACAGAATTTCCGAGCAGTGGCAGTAATTCAGTGCTCAATACCCCACCTAC
CACACCAGAGTCGCCTTCTTCAGTCACTATAACAGAAGCTAGTCAGCAGCAGTCTTCTGTCACAGTGTCA
GTGCCCCTGCCTCCAAACCAGGAAGAGGTTCGAAGCATTAAGAGTGAAACTGACAGCACAATTGAGGTGG
ACAGTGTTGTGGGGGAGCTCCAGGACCTCCAGTCGGAGGGGAATAGCTCACCAGCAGGCTTTGATGCGAG
CGTGAGTTCCAGCAGTAGCAATCAGCCAGAACCAGATAACCCAGAAAAAGCCTGTACAGGTCAGAAAAGA
GTGAAAGATACTCAGGGAGTAGGAAGTTCATCAAAAAAGCAGAAGAGAAGCCATAAAGCCACCGTGGTGA
ACAACAAAAAGAAGGGAAAAGGCACAAACAGTAGTGACAGTGAAGAACTCTCAGCTGGTGAAAGTGTGAC
TAAGACTCAGACAATCAAGTCAGTCCCCACCGGAATGAAGACCCACAACAGCAAGTCTCCAGCAAGGGTA
CAGTCTCCAGGAAAAGGTGGCAGGAATGGGGATAAAGACCCTGATCTCAAGGAGCCTAGTAACCGGCTTC
CCAAGGTTTACAAGTGGAGTTTTCAGACGTCGGACCTGGAAAATATGACAAGTGCTGAACGTATCTCAAT
TCTTCAAGAAAAATTGCAAGAAATCAGAAAGCATTATCTGTCTTTAAAATCTGAAGTAGCTTCCATTGAT
AGGAGGAGAAAACGTTTAAAGAAGAAAGAGAGAGAAAGTGCTGCTACATCTTCTTCCTCCTCTTCTCCCT
CGTCCAGCTCCATCACAGCTGCTGTTATGTTGACACTAGCTGAACCATCAATGTCCAGTGCATCACAGAA
TGGAATGTCAGTTGAGTGCAGGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_194262
ORF Size 3945 bp
Insert Size 3945
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_194262.2, NP_919238
RefSeq Size 6113
RefSeq ORF 3945
Locus ID 94246
Cytogenetics 13 A1|13 5.29 cM

Other Versions

Other products for "Arid4b"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
10 percent off protein banner ad
68 Mouse Clones
20%off selected tag antibodies