Atp8b2 (NM_001081182) Mouse Untagged Clone

CAT#: MC223971

Atp8b2 (untagged) - Mouse ATPase, class I, type 8B, member 2 (Atp8b2), (10ug)

USD 1,545.00


Availability*
6 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Atp8b2 (NM_001081182) Mouse Untagged Clone
Symbol Atp8b2
Synonyms Id
Vector pCMV6-Entry
Sequence Data
>MC223971 representing NM_001081182
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCACTGTGTGCAAAAAAGCGCCCCCCAGAAGAAGAGCGGAGGGCGCGGGCTAACGACCGTGAATACA
ATGAGAAATTCCAGTATGCGAGTAACTGCATCAAGACCTCCAAGTACAATATTGTCACCTTCCTGCCTGT
CAACCTCTTTGAGCAGTTCCAGGAAGTTGCCAACACCTACTTCCTGTTCCTTCTCATTCTGCAGTTAATC
CCCCAGATCTCGTCCCTGTCCTGGTTCACCACCATTGTGCCTTTGGTTCTCGTCCTCACCATCACAGCTG
TTAAAGATGCCACCGATGACTATTTCCGCCACAAGAGTGATAACCAGGTGAATAACCGTCATTCTCAGGT
GCTGATCAATGGAGTCCTCCAACAAGAGCAGTGGATGAATGTATGCGTTGGTGATATTATCAAGCTAGAA
AATAACCAGTTTGTGGCGGCGGACCTCCTCCTCCTTTCCAGCAGCGAACCCCACGGGCTGTGTTACATAG
AGACCGCAGAGCTGGATGGAGAGACCAACATGAAAGTGCGCCAGGCCATTCCAGTCACCTCAGAGCTGGG
AGACGTCAGTCAGCTGGCCAGGTTTGATGGCGAAGTAATCTGCGAACCACCCAACAACAAGCTGGACAAA
TTCAGTGGGACTCTGTACTGGAAGGAAAACAAGTTCCCCCTGAGCAACCAGAACATGCTGCTGAGAGGTT
GTGTGCTGAGAAACACTGAGTGGTGCTTCGGGCTGGTCATCTTTGCAGGTCCTGATACTAAGCTGATGCA
GAACAGCGGCAGGACGAAGTTCAAGAGAACAAGTATCGACCGCCTGATGAACACCCTGGTACTCTGGATT
TTTGGGTTCCTGGTTTGCATGGGGGTGATCCTGGCCATCGGTAATGCCATCTGGGAGCACGAAGTTGGGA
CGCGCTTCCAGGTCTACCTGCCCTGGGACGAGGCGGTGGACAGTGCCTTCTTCTCTGGCTTCCTCTCCTT
CTGGTCCTATATCATCATCCTCAACACCGTTGTGCCCATCTCACTGTACGTCAGTGTGGAAGTCATCCGC
TTGGGCCACAGCTACTTTATCAACTGGGACAAGAAGATGTTCTGCATGAAGAAGCGGACCCCTGCGGAGG
CCCGTACCACCACTCTGAACGAAGAGCTGGGCCAGGTGGAGTACATCTTCTCTGATAAGACGGGCACCCT
TACCCAGAACATCATGGTGTTCAACAAATGCTCCATCAACGGCCACAGCTATGGTGATGTGTTTGATGTC
TTGGGGCACAAAGCTGAATTGGGAGAGAGACCAGAGCCTGTTGACTTCTCCTTTAATCCACTGGCTGACA
AGAAATTCTTGTTTTGGGACTCGAGTCTCTTGGAGGCCGTCAAGATGGGGGACCCACACACGCACGAGTT
CTTCCGTCTCCTCTCCTTGTGTCACACTGTCATGTCAGAAGAAAAGAACGAAGGAGAGCTGTACTACAAA
GCTCAGTCTCCAGATGAGGGCGCTCTGGTCACCGCAGCCAGGAATTTTGGTTTTGTGTTCCGCTCTCGTA
CCCCTAAAACAATCACTGTCCATGAGCTCGGTACAGCCATCACCTACCAGCTGCTGGCCATCTTGGACTT
CAACAACATTCGCAAGCGGATGTCAGTCATAGTTCGGAATCCAGAGGGGAAGATACGACTCTACTGCAAA
GGGGCTGACACAATCCTGCTAGACAGGCTCCACCCTCCTACCCAGGAGCTGCTCAGCAGCACCACTGACC
ATCTGAATGAGTATGCAGGGGACGGGCTGAGGACCCTGGTGTTGGCCTACAAAGACCTGGATGAAGAGTA
CTATGAGGAGTGGGCCAGGAGACGCCTCCAGGCTAGCCTGGCCCAAGACAGCCGAGAGGACAGGCTAGCC
AGCATCTATGAAGAGGTTGAGAGTGACATGATGCTGCTGGGTGCCACGGCCATTGAGGACAAGCTTCAGC
AGGGAGTCCCAGAGACCATTGCCCTCTTGACTCTGGCCAACATCAAGATTTGGGTGCTAACAGGAGATAA
GCAAGAGACAGCTGTGAACATTGGCTACTCCTGTAAGATGCTGACTGACGACATGACAGAGGTGTTTGTA
GTCACAGGCCACACTGTCCTGGAGGTGCGAGAGGAGCTGAGGAAAGCCCGGAAGAAGATGGTAGATTCCT
CCCACGCTGTGGGCAACGGCTTCACCTACCAGGGGAACCTTTCTTCTTCAAAGCTCACTTCTGTCCTGGA
GGCTGTTGCTGGGGAGTACGCCTTGGTCATCAACGGGCACAGCCTGGCCCATGCCTTGGAGGCTGATATG
GAGCTAGAGTTTCTGGAGACAGCATGTGCCTGCAAAGCTGTCATCTGCTGTCGAGTGACACCCCTGCAGA
AGGCACAAGTGGTGGAACTGGTTAAGAAGTACAAGAAGGCAGTGACACTTGCCATTGGGGATGGAGCCAA
TGATGTCAGCATGATTAAAACTGCTCACATTGGTGTGGGCATCAGTGGGCAGGAAGGGATCCAGGCTGTC
CTGGCTTCCGATTATTCCTTTTCACAGTTCAAGTTCCTGCAACGCCTCCTGCTGGTGCATGGGCGCTGGT
CCTACCTACGCATGTGCAAGTTCCTCTGCTATTTCTTCTACAAGAACTTTGCGTTCACCATGGTCCACTT
CTGGTTTGGCTTCTTCTGCGGTTTCTCAGCCCAGACCGTTTATGACCAGTACTTCATCACCCTGTATAAC
ATCGTGTACACCTCCCTCCCCGTCCTAGCCATGGGCGTCTTTGACCAGGATGTCCCGGAACAGCGAAGCA
TGGAGTACCCTAAACTGTACGAGCCAGGCCAGTTGAACCTCCTATTCAACAAGCGAGAGTTCTTCATCTG
CATCGCCCAGGGCATCTACACCTCTGTGCTCATGTTCTTCATCCCCTATGGGGTGTTTGCGGAGGCCACT
CGGGATGATGGCACCCAACTGGCAGACTACCAGTCCTTTGCAGTCACTGTGGCCACATCGCTGGTCATTG
TGGTCAGTGTGCAGATTGGGCTGGATACAGGCTATTGGACAGCCATCAATCACTTCTTCATCTGGGGCAG
CCTTGCAGTGTACTTCGCCATCCTCTTTGCCATGCACAGCAATGGACTCTTTGACATGTTCCCAAACCAG
TTCCGGTTTGTGGGGAATGCCCAGAACACCCTGGCCCAGCCCACCGTGTGGCTCACCATCGCGCTCACCA
CGGCTGTCTGCATCATGCCTGTGGTTGCCTTCCGCTTCCTCAGGCTTAGCCTGAAGCCGGATCTCTCCGA
CACGGTCCGCTACACCCAGCTGGTAAGGAAGAAGCAGAAGGCGCAGCACCGCTGCATGCGGCGAGTGGGC
CGCACAGGCTCTCGGCGCTCTGGCTATGCCTTCTCTCATCAGGAAGGTTTTGGGGAGCTCATTATGTCTG
GCAAGAACATGCGGCTTAGCTCCCTGGCCCTCTCCAGCTTCAGCACGCGCTCCAGCTCCAGCTGGATCGA
GAGCCTGCGCAGGAAGAAAAGTGACAGTGCCAACAGCCCCAGTGGCGGAGCTGAGAAGCCCCTCAAGGGC
TGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001081182
ORF Size 3573 bp
Insert Size 3573
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001081182.2, NP_001074651
RefSeq Size 5459
RefSeq ORF 3573
Locus ID 54667
Cytogenetics 3|3 F1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.