Adamts19 (NM_175506) Mouse Untagged Clone

CAT#: MC223954

Adamts19 (untagged) - Mouse a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19 (Adamts19), (10ug)

USD 1,535.00


Availability*
7 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Adamts19 (NM_175506) Mouse Untagged Clone
Symbol Adamts19
Synonyms 4831407I23Rik; AU015154; D230034E10Rik
Vector pCMV6-Entry
Sequence Data
>MC223954 representing NM_175506
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGCCCGGAGATGCGCCTGACTCGCATCTGCTGCTGCTGCTGCCTCCTCTACCAGCTAGGCTTCCTGT
CGCATGGGACCACCTCAGGGTTGCAGCTCACCCCGGATCTCGAGGAATGGGAAGTCGTGTTTCCTGCACT
CTGGCGCCGGGAGTCGCTGAACGCCACGGGCCTCAGCGGGGGCAGCTCAGACCCGGGATCCGGGCGCAGC
TCTGGGGGCGGCGGCCGGGGGCAGGCTTCGGGCAGCTCGCGGGAGGTGCGCTCGGTGGCCCGAGCACCGC
AGGAAGAAGCCACCAGAGGCCAATCTGAGCCCTGGTTCGGGTCTCCCCTGGAGCCAGGTGCTGAGGACGA
GGAGGAACTCGAATCTCAGGAGCTGCCTCGGGGATCCAGCGGAGATACTGCCCTGTCCTCGGGAACCCCG
GCCTCGTGGCAGCCTCCTCTGCCCCCGCAACGGCCCTCGTCCCCGCCCCCTGCCCAGCAAGAGGAACCCA
GCGCGGAGGAGGTGCTGTTGCGGATCCCGGCCCTCTCCCGGGACCTGTACCTGCTGCTCCGGAGAGATGG
CCGCTTCCTGGCGCAGCGCTTCGCAGTGGAGCAGTGGCCCAAACCAGGTCCCGATCCCACCCGGGCAACG
GCTGACCCTGGCTCTTCCTTGCTGCCAGATGCCTCCTGCTTTTACACCGGGACAGTGCTGCGCCATCCTG
GCTCTCTGGCCTCTTTCAGCACCTGTGGAGGTGGCCTGATGGGCTTTATACAGCTCAATGAGGACTTCCT
ATTCATTGAGCCATTCAATGATACAATGGCCATCATAGGTCACCCGCACCGTTTATACAGGCAGAAGAGG
TCCACAGAGGAAAAAGTAACAGAGAACTCAGCTGTTCACCGCCATCACTGTGGTGTCATTTCAGATAAAG
GAAGACCAAGGTCTAAAAAAATAGCAGACAACAGACGAGAAAAACGGTATTCCTACAAATTATCCCAGGA
ATACAACATCGAGACCGTAGTAGTTGCAGACCCTGCAATGGTTTCCTACCACGGAGCAGATGCAGCCAGG
AGATTCATTCTGACAATCCTAAATATGGTTTTTAACCTTTTCCAGCACAAGAGTCTGGGTGTGCAGGTCA
ACCTCCGTGTGCTAAAGCTCATTCTCCTCCATGAAACACCAGCAGATCTGTATATTGGGCACCACGGAGA
GAAAATGCTGGAGAGTTTTTGTAAGTGGCAGCACGAAGAGTTTGGCCGGAGGAATGATGTGCATTTGGAG
ATGTCGACCAGCTGGGGAGAAGACATTGCTGCGGTGGATGCAGCTATTCTTATAACAAGGAAAGATTTCT
GTGTGCACAAAGATGAGCCATGTGACACTGTGGGTATTGCTTACTTGAATGGAATGTGTAGTGAAAAGAG
GAAGTGTATTATTGCTGAAGACAACGGCCTGAACCTTGCGTTTACAATCGCTCATGAAATGGGTCACAAC
ATGGGCATCAACCATGACAATGACCACCCATCCTGTGCTGATGGTCTTCATATCATGTCTGGTGAATGGA
TCAAAGGACAAAATCTTGGTGATGTTTCATGGTCCAGGTGCAGCAAGGAGGATCTGGAAAGATTTCTCAG
GTCAAAGGCCAGTAGCTGCTTGTTGCATACAGATCCGCAGAGTCTCAGTTCGGTGCTGGTTCCCTCAAAA
TTGCCAGGGATGGCTTACACTGCAGACGAACAGTGCCAGATCCTCTTTGGGCCTCTGGCTTCTTTTTGTC
AAGAGATGCAGCATGTTATCTGCACTGGTTTGTGGTGCAAAGTGGAGGGGGAAGCAGAGTGCAGGACCAA
GCTGGACCCACCAATGGATGGGACTGACTGCGACCCTGGCAAGTGGTGTAAGGCTGGAGAATGCACCCGC
AGGACTCCTGCACCCGAGCACTTGGCTGGAGAGTGGAGCCCGTGGAGTTCCTGTAGTCGAAGTTGCAGTT
CTGGGGTCAGCAGTCGAGAGCGCAAGTGTCCTGGGCTAGGTTCTGAAGCAAGGGATTGTAATGGCCCCAG
AAAACAATACAGAATATGTGAGAATCCACCTTGTCCTGCAGGTTTGCCTGGATTCAGAGACTGGCAATGT
CAGGCCTATAGTGTTAGAACTTCGTACCCAAAGCATGCACTTCAGTGGCAAGCTGTCTTCGATGAAGAAA
AACCATGTGCCTTGTTTTGCTCTCCTGTTGGAAAAGAACAGCCTGTTCTTCTATCAGAAAAAGTGATGGA
TGGAACTTCTTGTGGATATCAGGGACTAGATATATGTGCAAATGGCAGGTGCCAGAAAGCTGGTTGTGAT
GGTTTACTGGGGTCTCTTGCCAGGGAAGATCATTGTGGTGTTTGTAACGGCAATGGAAAGTCATGCAAAG
TCATTAAAGGCGATTTTAATCACACCAGAGGGGCAGGTTATGTAGAAGTTCTGGTGATACCTGCTGGAGC
GAGAAGAATCAAAGTTGTGGAGGAAAAGCCGGCACATAGCTTCTTAGCTCTTCGAGATGCCAGTAAGCAG
TCTATAAACAGTGACTGGAAGATAGAACATTCTGGAGCATTCAGTCTGGCTGGAACTACAGTACATTACT
TAAGACGAGGCCTGTGGGAGAAGATCTCTGCCAAAGGTCCCACAACCACACCTTTGCATCTCCTGGTACT
CCTATTTCAAGATCAGAATTACGGTCTTCACTATGAATATACTGTTCCATCAGACCCTCTTCCAGACAAT
CAGAGTTCTAAGGAGCCGGGGCCCCTCTTCATGTGGACACACGCAGGCTGGGGCGATTGCAATGCCACGT
GTGGAGGAGGAGAGAGGAAGACAATGGTGTCCTGCACAAAAATCATGAGCAAGAATATCAGCCTTGTGGA
CAACAAGAAATGCAAGGACTTGACCAAACCAGAGCCACAGATTCGAAAGTGCAATGAACAACCTTGTCAA
ACAAGGTGGATGATGACAGAATGGACCACGTGTTCACGAACCTGTGGAAAAGGAGTCCAGAGTAGACAAG
TGGCCTGTACCCAGCAGCTGGAAAATGGAACCCTGATTAGAGCCTGGGAGAGGGACTGCCTAGGGCCAAA
GCCCGCAACTGTGCAACGCTGTGAGGGTCAGGACTGCATGACGGTGTGGGAGGCCGGAGTGTGGTCGGAG
TGCTCAGTGAAGTGTGGCAAAGGTGTGCGGCATCGCACCGTGAGGTGCACTAACCCGAGAAAAAAGTGCG
TCCTCTCCACCAGACCCAGGGAGGCCGAGGACTGTGAGGATTACTCCAAATGCTACGTGTGGCGAGTAGG
TGACTGGTCTAAGTGCTCCATTACCTGTGGCAAAGGCATGCAGTCTCGTGTTATCCAGTGCATGCATAAG
ATCACAGGAAGACACGGAAATGAATGCTTTTCTTCGGAGAAACCTGCAGCCTACAGGCCATGTCACCTTC
AGCCCTGTAATGAGAAAATTAATGTAAATACAATAACATCACCAAGACTGGCTGCCCTGACCTTCAAGTG
CCTGGGAGACCAGTGGCCAGTGTACTGCAGAGTGATCCGGGAGAAGAATCTTTGCCAGGACATGCGGTGG
TACCAACGATGCTGTGAGACTTGCAGGGACTTCTATGCCCAAAAGCTACAGCAGAAGAGTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_175506
ORF Size 3633 bp
Insert Size 3633
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_175506.3, NP_780715
RefSeq Size 4666
RefSeq ORF 3633
Locus ID 240322
Cytogenetics 18|18 D3
Gene Summary This gene encodes a member of 'a disintegrin and metalloproteinase with thrombospondin motifs' (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016].
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.