Ambra1 (NM_001080754) Mouse Untagged Clone

CAT#: MC223952

Ambra1 (untagged) - Mouse autophagy/beclin 1 regulator 1 (Ambra1), transcript variant 2, (10ug)

USD 1,535


Availability*
6 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Ambra1 (NM_001080754) Mouse Untagged Clone
Symbol Ambra1
Synonyms 2310079H06Rik; A130023A14; AA474864; AV021921; D030051N19Rik; mKIAA1736
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC223952 representing NM_001080754
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAAGTTGTCCCAGAGAAGAATGCTGTACGAATCCTCTGGGGCCGAGAACGGGGCACTCGTGCCATGG
GTGCCCAGCGGCTTCTGCAGGAGCTGGTGGAGGATAAGACTCGATGGATGAAATGGGAGGGCAAGAGAGT
AGAACTGCCTGATAGTCCACGCTCGACCTTCTTACTGGCCTTCAGCCCAGACAGGACTCTCTTGGCATCC
ACACATGTGAACCATAACATCTATATTACAGAGGTTAAGACTGGCAAGTGTGTTCACTCTCTGATCGGAC
ACCGCCGTACTCCATGGTGTGTCACTTTTCACCCCACCATCTCAGGCCTTATTGCTTCTGGTTGCCTAGA
TGGGGAAGTTAGGATTTGGGATTTACATGGGGGCAGTGAAAGCTGGTTCACAGACAGCAACAATGCCATA
GCCTCCTTGGCTTTCCACCCTACGGCTCAGCTTCTACTAATTGCCACTGCAAATGAGATCCATTTCTGGG
ATTGGAGTCGTCGGGAGCCCTTTGCTGTGGTGAAAACAGCCAGTGAGATGGAGCGTGTCCGCCTGGTGAG
ATTTGATCCACTTGGACACTACTTACTTACAGCTATTGTTAACCCTTCTAATCAGCAGGGTGATGACGAA
CCAGAAATCCCTATAGATGGAACAGAGTTATCTCATTACCGTCAACGTGCCCTCCTGCAATCACAGCCAG
TTCGCCGGACACCTCTCCTCCACAATTTCCTGCACATGCTGTCCTCCCGTTCCTCTGGCATCCAGACCGA
GCCCTTCCATCCCCCGGAGCAGGCTTCATCAACGCAGCAGGACCAGGGCCTCCTGAACCGGCCGTCTGCC
TTCAGTACAGTCCAGAGCAGCACTGCGGGCAACACGCTCCGCAACCTCAGTCTGGGTCCTACCCGGCGCT
CTTTGGGGGGCCCTTTGTCTAGCCACCCTTCTAGGTATCACAGAGAACTAGCCCCTGGGCTGACAGGTTC
TGAGTGGACCCGGACAGTACTCACTCTGAACTCTCGTTCTGAGGTAGAATCTATGCCCCCACCGAGGACC
AGTGCCTCCTCAGTGAGTTTGCTTTCTGTACTGAGACAGCAGGAAGGTGGCTCTCAGGCATCTGTGTATA
CTTCAGCCACAGAAGGGAGGGGTTTTCCATCATCAGGGTTGGCAACTGAGTCAGATGGAGGGAATGGTTC
CAGCCAAAACAACTCAGGCAGCATTCGCCATGAGCTTCAATGTGACCTGAGACGCTTCTTTTTGGAGTAT
GACAGGCTGCAGGAGCTGGATCAGAGCCTGAGTGGGGAAACTCCCCAGACCCAACAGGCCCAGGAAATGC
TCAACAATAATATTGAATCTGAGAGACCAGGTCCTTCCCACCTGCCTACCCCACACAGCAGTGAGAACAA
CTCCAACCTGTCTCGGGGCCACCTTAATCGATGCCGTGCTTGCCATAATCTTCTAACCTTCAACAATGAT
ACCCTTCGTTGGGAAAGAACCACACCTAACTACTCATCTGGTGAGGCTAGCTCTTCCTGGCACGTCTCCA
CTACCTTTGAGGGCATGCCACCAAGTGGCAACCAGCTACCACCTCTTGAGCGGACTGAGGGCCAAATGCC
TAGCTCCAGCAGGCTGGAGTTGAGCAGCTCTGCTAGTTCACAAGAGGAGAGGACTGTGGGGGTGGCCTTT
AACCAGGAGACAGGCCACTGGGAACGCATTTATACCCAGTCCAGCAGATCTGGAACTGTATCACAGGAGG
CCTTACATCAAGATATGCCTGAAGAAAGCTCTGAGGAAGACTCCCTCAGGAGGAGGCTGCTGGAGTCTTC
CCTCATTTCATTATCCCGTTATGATGGAGCAGGATCCAGAGAGCACCCAATTTACCCAGACCCAGCGAGA
TTATCTCCTGCTGCATACTACGCCCAGAGGATGATCCAGTATCTCTCAAGGAGAGACAGTATTCGCCAGC
GCTCCATGCGCTACCAACAGAATCGGCTTCGTTCTTCCACCTCCTCTTCTTCCTCAGACAACCAGGGTCC
ATCAGTAGAGGGAACCGACTTGGAATTTGAGGACTTTGAGGACAATGGTGACAGATCTAGGCACCGAGCT
CCCCGAAATGCCCGAATGTCTGCACCTTCACTTGGACGATTTGTTCCAAGGCGTTTTTTGCTGCCTGAGT
ACTTGCCTTATGCTGGGATTTTTCATGAACGTGGACAGCCTGGCTTGGCTACTCATTCTTCTGTTAACAG
GGTCCTGGCAGGGGCAGTAATTGGAGATGGACAGTCTGCTGTGGCCAGTAACATTGCCAATACTACCTAC
AGGCTCCAGTGGTGGGACTTCACTAAGTTTGACCTTCCAGAAATCAGTAATGCCTCTGTGAATGTCCTGG
TACAGAATTGCAAGATCTACAATGATGCCAGCTGTGACATTTCTGCAGATGGTCAGCTCCTGGCAGCCTT
CATCCCGAGCAGCCAGAGGGGCTTTCCTGATGAAGGCATCCTGGCAGTGTATTCCCTGGCCCCCCATAAC
TTGGGGGAAATGCTCTACACCAAGCGATTTGGTCCCAATGCCATTTCTGTAAGCCTGTCCCCGATGGGCC
GATACGTTATGGTGGGCTTGGCCTCACGAAGGATCCTACTGCACCCCTCCACAGAGCACATGGTAGCCCA
GGTCTTCAGGCTGCAACAGGCCCATGGTGGTGAGACTTCCATGAGGAGAGTTTTCAATGTCCTTTACCCC
ATGCCTGCAGACCAACGGAGACACGTCAGCATCAACTCTGCCCGTTGGCTACCCGAGCCAGGGCTTGGTT
TGGCCTATGGCACCAACAAAGGAGACTTGGTGATCTGCCGACCAGAGGCCTTAAACTCTGGCATCGAGTA
CTACTGGGACCAGCTAAGTGAAACAGTCTTCACTGTCCACTCAAGTAGCAGGAGCAGCGAGCGGCCTGGA
ACCAGCAGAGCCACGTGGCGGACAGACAGAGACATGGGTTTGATGAATGCAATTGGGCTGCAGCCTCGGA
ACCCAACCACCTCTGTGACATCTCAGGGCACCCAGACTCTGGCCCTCCAGTTGCAGAACGCTGAAACACA
GACTGAGAGGGAGGAAGAGGAACCAGGGGCAGCATCTTCAGGTCCTGGTGAAGGCGAGGGCTCAGAATAT
GGTGGCAGTGGGGAAGATGCCCTCAGCAGGATCCAGAGGCTGATGGCCGAGGGTGGCATGACAGCTGTGG
TACAACGGGAACAGAGCACCACCATGGCCTCCATGGGTGGCTTTGGCAACAACATCATCGTTAGCCACCG
CATTCACCGCAGCTCCCAGACAGGCACAGAGTCAGGGGCTGCTCGTACCTCCTCACCCCAGCCCTCCACC
TCTCGAGGACTGCCATCAGAACCTGGGCAACTGGCAGAGCGAGCGCTAAGCCCCCGGACAGCCTCCTGGG
ACCAGCCTAGTACCTCTGGGAGGGAACTACCCCAGCCAGCCCTGTCCTCTTCCTCCCCTGTCCCCATTCC
AGTCCCCCTTGCCAGCAATGAGGGACCAACCATGCACTGCAATGTGACCAATAACAGTCACCTTCCTGAG
GGTGATGGTAGCAACAGGGGGGAAGCTGCAGGCCCTAGTGGAGAGCCACAGAACCGATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001080754
ORF Size 3630 bp
Insert Size 3630
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001080754.1, NP_001074223
RefSeq Size 5056
RefSeq ORF 3630
Locus ID 228361
Cytogenetics 2|2 E1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.