Ptpn21 (NM_001146199) Mouse Untagged Clone

CAT#: MC223827

Ptpn21 (untagged) - Mouse protein tyrosine phosphatase, non-receptor type 21 (Ptpn21), transcript variant 2, (10ug)

USD 1,494.00


Availability*
6 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Ptpn21 (NM_001146199) Mouse Untagged Clone
Symbol Ptpn21
Synonyms PTPD1; PTPRL10
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC223827 representing NM_001146199
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCACTGCCATTTGGATTGAAATTGAAACGCACCCGACGCTACACTGTGTCCAGCAAGAGCTGCCTGG
TTGCCCGGATCCAGCTGCTCAATAATGAGTTTGTGGAGTTCACTCTGTCTGTGGAGAGCACTGGCCAGGA
GAGCCTAGAAGCTGTGGCCCAGCGCCTGGAGCTGAGAGAGGTCACTTACTTTAGCCTCTGGTACTACAAC
AAGCAGAATCAGCGGCGCTGGGTGGATTTGGAGAAACCCCTGAAGAAGCAGCTGGACAAGCACGCACTGG
AGCCTACCGTCTACTTCGGCGTGCTATTCTATGTGCCTTCTGTTTCCCAGCTGCAGCAGGAGATTACCAG
GTATCAGTATTACCTGCAGCTGAAGAAAGATATTCTGGAAGGAAACCTTCCCTGTACATTAGAACACGCC
ATTCAGCTGGCCGGCTTAGCTGTTCAAGCTGATTTTGGTGACTTTGATCAGTATGAATCCCAAGATTTTC
TTCAGAAATTTGCCTTGCTCCCCGTGGCATGGCTACAGGATGAAAAAGTGCTGGAAGAAGCAGCCCAGAA
AGTGGCCTTACTGCACCAGAAATACAGAGGGCTCACAGCTCCTGAGGCCGAGCTGCTGTACATGCAGGAG
GTAGAGAGAATGGATGGCTACGGAGAGGAGAGCTACCCTGCCAAGGACAGCCAAGGAAGTGACATATCCA
TTGGTGCCTGTCTCGATGGCATCTTTGTGAAACACAAGAACGGAAGGCCTCCTGTGGTGTTCAGGTGGCA
CGACATTGCTAACATGTCGCATAACAAGTCCTTTTTTGCACTAGAGCTGGCAAATAAAGAGGAGACCATC
CAGTTTCAAACTGAAGACATGGAGACAGCCAAGTACGTGTGGCGGCTGTGTGTGGCACGGCACAAATTCT
ACAGACTGAACCAGTGTAGCCTGCAAACGCAGGCCGCCACGCTGAACTCAGTCAGGAGGGGCTCATCCTC
CAGGATGTCTCTGCCTAAACCCCAGCCCTATGCGATGCCTCCCCCACCCCAGCTGCATTATAATGGACAT
TATACAGAGCCATTTGCTTCTTCCCAAGACAACATCTTTGTGCCCAACAAGAATGGATTCTACTGTCACT
CCCAGACAAGCCTGGATAGAACCCAGATTGACCTCAGTGGTCGCATCCGCAACGGCAGCGTCTACAGTGC
ACACAGTACGAATTCCTTAAACACACTTCAGCCCTACCTGCAGCCCTCCCCCATGTCCTCCAACCCGAGT
ATCACTGGCAGTGATGTCATGAGACCCGACTACATCCCGTCCCACCGGCACAGTGCGCTCATTCCCCCGT
CTTACCGCCCGACCCCTGACTACGAGACCGTGATGAAGCAGCTCAACAGAGGCATGGTGCACGCAGACCG
GCACAGCCACTCGCTGAGGAACCTCAACATTGGCAGTTCCTATGCGTACAGCCGGCCCGACGCCTTGGTC
TACAGCCAGCCCGAGATTCGGGAGCACCCTCACCTCACCTCTCCCCAGTCAGCCCACTACCCCTTTAACC
TGAACTACAGTTTCCACAGCCAGTCTCCGTATCCCTACCCTGCCGAGAGGCGGCCAGTGGTGGGCGCCGT
GAGTGTGCCTGAACTGACAAATGTGCAGCTGCAGGCTCAGGACTACCCAGCTCCAAACATTATGAGAACC
CAGGTGTACCGCCCACCCCCGCCGTATCCTTACCCAAGACCTGCCAACAGCACCCCAGACCTGTCCCGCC
ACCTCTACATCAGCAGCAGCAATCCGGATCTCATCACCAGGCGCGTCCATCACTCAGTGCAGACCTTCCA
GGAGGACAGCTTGCCCGTGGCTCACTCTCTGCAGGAGGTCAGCGAGCCCCTCACAGCAGCGCGCCATGCC
CACCTACAGAAGAGGAACAGTATTGAAATCGCAGGGCTCACACATGGATTCGAAGGCCTGAGGCTCAAGG
AGAGGACGGTGTCAGCCTCAGCAGCAGACGTGGCGCCCCGGACCTTCTCAGCAGGCTCCCAGTCCAGCGT
CTTCTCTGACAAAATGAAGCAGGAGGGGACTGAAGAGCAGGAGGGTGGCAGATACAGCCATAAGAAGTCC
CTTTCTGATGCCACCATGCTGATTCATAGCAGTGAGGAGGACGAGGACTTGGAAGAGGACAGCAGCAGAG
AACAGGCCATCTCAGCTGTGTCTGAGCCCCGCCTTACGGCCGCTTTCTCTCAGGAACTAAACTACCCCTG
TGCTTCAGCGACTCCGATCACTGGGCCTCTGCATATTTTTGAGCCCAAGCCCCATGTCACAGAGCCTGAG
AAGAGGGCAAAGGACATCAGCCCTGTCCACCTGGTTGTGGAGACCCATCGGCCCCGAAGAGATGGACTGC
TGACCCCCTCCATGTCCGAGTCAGACCTCACGACCTCAGGGAGGTACCGAGCTAGGAGGGACTCTGTCAA
GAAAAGGCCAGTGTCAGACCTCCTCTCTGGGAAAAAAAGCGCTGTGGAAGGACTTCCGCCACTAGGGGGG
ATGAAAAAAACTCGAGCAGATGCAAAAAAAATTGGTCCCCTCAAGCTGGCAGCCCTCAATGGGCTCTCCC
TGTCCCGGCTGCCCCTGCCTGATGAAGGAAAAGAAGTGTCCACCAGAGCGACAAATGACGAGAGGTGCAA
GGTTCTGGAGCAGCGGTTAGAGCAAGGCATGGTCTTCACCGAATATGAGAGGATCCTTAAGAAGCGGCTG
GTTGATGGTGAGTGCTCGACTGCCCGGCTCCCTGAAAATGCAGAGAGAAATCGATTTCAAGATGTGCTCC
CCTACGATGATGCGAGAGTCGAGTTGGTGCCAACCAAGGAGAACAACACTGGCTACATCAACGCGTCACA
CATTAAGGTCTCTGTCAGCGGAATAGAATGGGATTATATTGCCACACAGGGACCATTACAAAATACCTGC
CAGGACTTTTGGCAGATGGTGTGGGAACAGGGAGTCGCAATTATAGCAATGGTGACAGCAGAAGAGGAGG
GAGGCCGGGAGAAGAGCTTTAGGTACTGGCCACGGCTTGGTTCCAGGCACAACACTGTCACCTATGGAAG
GTTTAAGATCACAACGCGCTTCCGCACGGACTCGGGCTGCTATGCCACCACAGGTTTGAAGATGAAGCAC
CTTCTCACAGGGCAGGAGAGAACCGTTTGGCATCTTCAGTACACAGACTGGCCTGAACACGGCTGTCCCG
AAGACCTCAAAGGATTTTTATCCTACCTTGAAGAGATCCAGTCAGTTCGACGTCATACAAACAGTACCAG
TGAACCCAAAAGCCACAATCCCCCGCTGCTGGTGCACTGCAGTGCTGGCGTGGGAAGAACTGGGGTCGTC
ATTCTGTCAGAGATCATGGTTGCCTGTCTGGAACACAATGAGGTGCTGGACATCCCCAGAGTGCTGGACA
TGCTGAGGCAGCAGAGGATGATGCTGGTGCAGACACTTGGCCAGTACACCTTTGTGTACAGAGTGCTCAT
TCAGTTCCTGAAAAGCTCCAGGCTCATTTAA


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII     
Tag Tag Free
ACCN NM_001146199
ORF Size 3531 bp
Insert Size 3531
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001146199.1, NP_001139671
RefSeq Size 5562
RefSeq ORF 3531
Locus ID 24000
Cytogenetics 12|12 E
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.