Jak1 (NM_146145) Mouse Untagged Clone

CAT#: MC223732

Jak1 (untagged) - Mouse Janus kinase 1 (Jak1), (10ug)

  View "NM_146145" in other vectors (6)

USD 1,510.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Jak1 (NM_146145) Mouse Untagged Clone
Symbol Jak1
Synonyms AA960307; BAP004; C130039L05Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>MC223732 representing NM_146145
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGTATCTAAATATAAAAGAGGACTGCAATGCCATGGCGTTCTGTGCTAAAATGAGGAGCTTCAAGA
AGACTGAGGTGAAGCAGGTGGTCCCTGAGCCTGGAGTGGAGGTGACTTTCTATCTGTTGGACAGGGAGCC
CCTCCGCCTGGGCAGCGGAGAGTATACAGCCGAGGAGCTGTGCATCAGGGCCGCCCAGGAGTGCAGTATC
TCTCCTCTCTGTCACAACCTCTTCGCCCTGTACGATGAGAGCACCAAGCTCTGGTACGCTCCGAACCGAA
TCATCACTGTGGATGACAAAACGTCTCTCCGGCTCCACTACCGCATGAGGTTCTACTTTACCAACTGGCA
CGGAACCAATGACAACGAACAGTCTGTATGGCGACATTCTCCAAAGAAGCAGAAAAACGGCTATGAGAAG
AAAAGGGTTCCAGAAGCAACCCCACTCCTTGATGCCAGTTCACTGGAGTATCTGTTTGCACAGGGACAGT
ATGATTTGATCAAATGCCTGGCTCCCATTCGGGACCCCAAGACGGAGCAAGACGGACATGATATTGAAAA
TGAGTGCCTGGGCATGGCGGTCCTGGCCATCTCCCACTATGCCATGATGAAGAAGATGCAGTTGCCGGAA
CTTCCCAAAGACATCAGCTACAAGCGATATATTCCAGAAACATTGAATAAATCCATCAGACAGAGGAACC
TTCTTACCAGGATGCGAATAAATAATGTTTTCAAGGATTTCTTGAAGGAATTTAACAACAAGACCATCTG
TGACAGCAGTGTGTCTACACATGACCTGAAGGTGAAATACCTGGCTACCTTGGAAACTTTGACAAAACAT
TATGGAGCTGAAATATTTGAGACTTCTATGCTACTGATTTCATCAGAAAATGAATTGAGTCGATGCCATT
CGAATGACAGTGGCAATGTTCTCTATGAGGTCATGGTGACTGGAAATCTCGGGATCCAGTGGCGGCAGAA
ACCAAATGTTGTTCCTGTTGAAAAGGAAAAAAATAAACTGAAGCGGAAAAAACTGGAATATAATAAACAC
AAGAAGGATGATGAGAGAAACAAACTCCGGGAAGAGTGGAACAATTTTTCCTATTTCCCTGAAATCACCC
ACATTGTAATAAAGGAGTCTGTGGTCAGCATTAACAAACAGGACAACAAAAACATGGAACTCAAGCTCTC
TTCTCGAGAGGAAGCCTTGTCCTTTGTGTCCCTGGTGGATGGCTACTTCCGGCTCACTGCAGATGCCCAC
CATTACCTCTGTACTGATGTGGCTCCCCCACTGATTGTCCACAATATACAGAACGGCTGCCACGGTCCAA
TCTGCACAGAATATGCCATCAATAAGCTGCGGCAGGAAGGGAGTGAAGAGGGGATGTACGTGCTGAGGTG
GAGCTGCACCGACTTTGACAACATTCTTATGACTGTCACCTGCTTTGAAAAGTCTGAGGTATTGGGTGGC
CAGAAGCAGTTCAAGAACTTTCAGATTGAGGTACAGAAGGGCCGCTACAGCCTGCATGGCTCTATGGACC
ACTTTCCCAGCCTGCGAGACCTCATGAACCACCTCAAGAAGCAGATCCTGCGCACGGACAACATAAGCTT
TGTGCTGAAACGATGCTGTCAGCCTAAGCCTCGAGAAATCTCCAATCTGCTCGTAGCCACTAAGAAAGCC
CAGGAGTGGCAGCCTGTCTACTCCATGAGCCAGCTGAGCTTTGATCGGATCCTTAAGAAAGATATTATAC
AAGGTGAGCACCTTGGCAGAGGCACAAGAACACATATCTATTCTGGGACCCTGCTGGACTACAAGGATGA
GGAAGGAATTGCTGAAGAGAAGAAGATAAAAGTGATCCTCAAAGTCCTAGACCCCAGCCACCGGGACATC
TCTCTGGCCTTCTTTGAGGCTGCTAGCATGATGAGACAGGTTTCCCACAAACATATAGTGTACCTCTACG
GCGTGTGTGTCCGAGATGTGGAAAATATCATGGTGGAAGAGTTTGTGGAGGGGGGGCCGTTGGATCTCTT
CATGCACCGGAAAAGTGATGCGCTTACTACCCCCTGGAAGTTCAAGGTTGCCAAACAGCTGGCCAGTGCC
CTGAGTTACTTGGAAGATAAAGACCTGGTTCATGGAAATGTGTGCACTAAAAACCTCCTTCTGGCCCGTG
AGGGCATTGACAGTGACATTGGCCCGTTCATCAAGCTTAGTGACCCTGGCATCCCAGTCTCTGTGCTGAC
CAGGCAAGAGTGCATAGAGCGAATCCCCTGGATCGCTCCTGAGTGTGTTGAAGACTCCAAGAACCTGAGT
GTGGCTGCTGACAAGTGGAGCTTTGGAACCACGCTCTGGGAAATCTGCTACAACGGAGAGATTCCTCTCA
AAGACAAGACCCTCATTGAGAAAGAGAGGTTTTATGAAAGCCGCTGCAGGCCTGTGACTCCATCTTGCAA
GGAGCTAGCTGACCTCATGACTCGCTGCATGAACTATGACCCCAACCAGAGACCCTTCTTCCGAGCCATC
ATGAGGGACATTAACAAGCTGGAGGAGCAGAATCCAGACATTGTTTCAGAAAAGCAGCCAACAACAGAGG
TGGACCCCACTCACTTTGAAAAGCGGTTCCTGAAGAGGATTCGTGACTTGGGAGAGGGTCACTTTGGGAA
GGTTGAGCTCTGCAGATATGATCCTGAGGGAGACAACACAGGGGAGCAGGTAGCTGTCAAGTCCCTGAAG
CCTGAGAGTGGAGGTAACCACATAGCTGATCTGAAGAAGGAGATAGAGATCTTACGGAACCTCTACCATG
AGAACATTGTGAAGTACAAAGGAATCTGCATGGAAGACGGAGGCAATGGTATCAAGCTCATCATGGAGTT
TCTGCCTTCGGGAAGCCTAAAGGAGTATCTGCCAAAGAATAAGAACAAAATCAACCTCAAACAGCAGCTA
AAATATGCCATCCAGATTTGTAAGGGGATGGACTACTTGGGTTCTCGGCAATACGTTCACCGGGACTTAG
CAGCAAGAAATGTCCTTGTTGAGAGTGAGCATCAAGTGAAGATCGGAGACTTTGGTTTAACCAAAGCAAT
TGAAACCGATAAGGAGTACTACACAGTCAAGGACGACCGGGACAGCCCAGTGTTCTGGTACGCTCCGGAA
TGTTTAATCCAGTGTAAATTTTATATCGCCTCTGATGTCTGGTCTTTTGGAGTGACACTGCACGAGCTGC
TCACTTACTGTGACTCAGATTTTAGTCCCATGGCCTTGTTCCTGAAAATGATAGGCCCAACTCATGGCCA
GATGACAGTGACACGGCTTGTGAATACTCTGAAAGAAGGAAAGCGTCTGCCATGTCCACCCAACTGTCCT
GATGAGGTTTATCAGCTTATGAGAAAATGCTGGGAATTCCAACCATCTAACCGGACAACTTTTCAGAACC
TTATTGAAGGATTTGAAGCACTTTTAAAATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_146145
ORF Size 3462 bp
Insert Size 3462
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_146145.2, NP_666257
RefSeq Size 5299
RefSeq ORF 3462
Locus ID 16451
Cytogenetics 4 C6|4 46.19 cM

Other Versions

Other products for "Jak1"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones