Stxbp5l (NM_001114613) Mouse Untagged Clone

CAT#: MC223661

Stxbp5l (untagged) - Mouse syntaxin binding protein 5-like (Stxbp5l), transcript variant m, (10ug)

USD 1,432.00


Availability*
6 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Stxbp5l (NM_001114613) Mouse Untagged Clone
Symbol Stxbp5l
Synonyms 9430094L02; A830015P08Rik; LLGL4; T2dm1; t2md1; tomosyn-2
Vector pCMV6-Entry
Sequence Data
>MC223661 representing NM_001114613
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGAAGTTTAATTTCCGAAAAGTTTTGGATGGCTTAACTGCCTCTTCCCCTGGCAGTGGTAGCAGCA
GTGGCAGTAACAGTGGTGGGGCTGGAAGTGGCTCTGTCCATCCAGGAGGGACTGCAGGGCTTCCGAGAGA
GGAAATTCAGGAAAGCCTGACTTCAGACTATTTCCAGATTTGCAAGACAGTTCGGCATGGGTTTCCTTAT
CAGCCCACAGCATTGGCCTTTGATCCAGTCCAGAAAATCTTAGCTATTGGAACAAGAACAGGTGCTATAC
GAATACTTGGGAGGCCTGGTGTTGACTGTTACTGCCAACATGAAAGTGGTGCGGCTGTCTTGCAGCTCCA
ATTCCTCATCAATGAGGGCGCGTTGGTCAGTGCGAGTTCAGATGACACGCTTCATTTGTGGAATCTGAGA
CAGAAAAGGCCGGCCATTCTCCATTCTCTTAAATTTAACAGAGAACGAATTACTTACTGTCATCTACCTT
TCCAGAGTAAATGGCTCTATGTTGGAACAGAAAGAGGAAATACACATATTGTAAATATTGAATCTTTCAT
TCTTTCTGGATATGTCATCATGTGGAACAAGGCAATTGAACTCTCCACCAAGACTCATCCAGGCCCAGTT
GTACATTTAAGTGATAGCCCAAGAGATGAAGGAAAACTGTTAATAGGTTACGAGAATGGCACTGTGGTGT
TCTGGGACTTGAAATCTAAAAGAGCAGAACTGAGAGTTTATTATGATGAGGCTATTCATTCAATTGATTG
GCATCATGAGGGCAAACAATTCATGTGCAGCCACTCAGATGGTAGCTTGACTTTATGGAACCTGAAAAGC
CCAAGCCGCCCTTTCCAAACCACAGTCCCACATGGAAAAAGTCAAAGAGAAGGAAGAAAGTCTGAGTCTT
GTAAACCTATTCTTAAAGTAGAATACAAAACGTGCAGGAACAGTGAACCATTTATAATATTCTCTGGCGG
GCTGTCATATGACAAAGCTTGCAGAAGACCAAGTTTAACCATCATGCATGGGAAAGCAATTACAGTGCTT
GAGATGGATCATCCTATTGTTGAGTTTCTAACGTTATGTGAAACGCCCTATCCAAATGAATTTCAAGAAC
CCTATGCTGTTGCTGTACTTCTAGAGAAAGATCTCATCGTAGTTGACCTGACACAAACCAATTTTCCAAT
CTTTGAAAATCCATATCCAATGGACATTCATGAGTCACCTGTTACATGCACAGCATATTTTGCCGATTGC
CCTCCAGATTTGATTCTAGTACTCTATTCTATAGGAGTCAAGCATAAAAAACAAGGATACAGTAATAAGG
AATGGCCAGTCAGTGGAGGAGCTTGGAACCTCGGAGCACAAACTTATCCAGAAATTATTATTACTGGTCA
TGCTGATGGAACAATAAAATTTTGGGATGCTTCAGCAATGACACTGCAGATGTTGTACAAGCTAAAAACT
TCCAAAGTGTTTGAAAAGCAGAAGGCAGGAGAAGGCAAACAGACGTGTGAACTTGTAGAGGAAGATCCCT
TTGCTGTGCAGATGATCTACTGGTGTCCAGAGAGCAGAATATTTTGTGTCTCTGGAGTCTCTGCATATGT
CATAATTTATAAATTCAGCAGACATGAAGTCACAACAGAAATAGTGTCACTAGAGGTACGACTTCAGTGT
GATGTTGAAGACATTATTACTCCTGAGCCAGAAACAAGCCCTCCATTTCCAGATCTCTCCTCTCAACTTC
CTCCTTCAAGGAGTCTTTCTGGAAGCACTAATACTGTGTCTAGTGAAGGAGTGACAAAGGACAGCATCCC
GTGCCTCAGTGTTAAAACACGGCCAGTACGAATGCCGCCGGGCTATCAAGCAGATCTTGTTATTCAGTTG
GTGTGGGTAGATGGTGAGCCTCCTCAGCAAATTACCAGCCTTTCTATAAGCTCAGCATATGGAATAGTGG
CATTTGGAAACTGCACTGGGCTGGTTGTGGTGGATTTCATACAGAAGACAGTGCTATTAAGCATGGGGAC
CATTGACCTCTATAGATCAAGTGACCTGTACCAGCGACAGCCCCGGTCTCCTCGAAAGAACAGGCAGTTC
ATTGCAGACAACTTTTGCATGCGTGGGCTGTCTAACTTTTATCCTGATTTAACGAAACGGATCCGTACTT
CCTATCAGAGCTTAACAGAGCTGAATGATAGTCCAGTTCCCCTGGAACTTGAGCGCTGCAAGTCCCCCAC
CTCAGAAACCCGAGAGAATTCCTATAATCGCTCCAGGAGCTCTAGCATCTCCAGTATTGACAAAGATTCT
AAAGAAGCAATTACAGCTTTATACTTCATGGAATCCTTTGCACGGAAAAATGACTCTACCGTTTCCCCTT
GTCTGTTTGTTGGAACTAGTCTGGGAATGGTAGTACTCATCTCCCTAAATCTACCATCATCAGATGAACA
AAGGTTTACAGAGCCGGTGGTGGTATTGCCAAGTGGTACATTCCTCTCACTGAAAGGAGCAGTGCTAACA
TTTTCCTGCATGGACAGAACTGGCAGTTTAATGCAGCCTCCATACGAAGTATGGAGAGATCCAAACAACA
CAGATGAAAATGAAAAAACCTGGAAAAGGAAATTGGTCATGAACTACTCGTCTTCATCCCAAGAGATGGG
AGACCATCAGTATACGATAATCTGCTCAGAAAAACAAGCCAAAGTCTTCTCACTGCCTTCCCAGACCTGC
CTTTATGTTCACAACATCACCGAGACGTCGTTCATATTGCAAGCAGATGTGGTGGTCATGTGCAACAGTG
CCTGCCTGGCCTGCTTTTGTGCAAATGGGCATATCATGATAATGAGCTTACCTAGTCTTCGCCCAATGTT
GGATGTTAATTATTTGCCACTGACAGACATGAGAATAGCACGGACATTTTGTTTTACTAATGAAGGACAG
GCATTATACCTCGTCTCTCCCACTGAAATTCAACGGTTAACATATAGCCAAGAAATGTGTGATAATATTC
AGGACATGTTAGGCGATTTGTTTACTCCCATAGAGACACCAGAAGCCCAAAATAGAGGCTTTCTCAAGGG
ACTATTTGGTGGAAGTGGACAGACATTCGACAGAGAAGAACTCTTCGGGGAAGCCTCAGCAGGAAAAGCA
TCCCGAAGCCTCGCACAGCACATCCCTGGGCCAGGTAGTATAGAAGGGATGAAAGGTGCTGCTGGCGGGG
TGATGGGAGAGCTGACCCGAGCCCGGATTGCACTTGATGAGAGAGGGCAGCGTCTGGGCGAGCTGGAAGA
GAAGACTGCGGGCATGATGACCAGCGCAGAAGCGTTTTCCAAGCACGCACATGAGCTAATGCTGAAGTAT
AAGGATAAGAAGTGGTACCAGTTCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001114613
ORF Size 3387 bp
Insert Size 3387
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001114613.1, NP_001108085
RefSeq Size 11893
RefSeq ORF 3387
Locus ID 207227
Cytogenetics 16 26.32 cM|16 B3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.