Upf1 (NM_001122829) Mouse Untagged Clone

CAT#: MC223643

Upf1 (untagged) - Mouse UPF1 regulator of nonsense transcripts homolog (yeast) (Upf1), transcript variant 1, (10ug)

  View "NM_001122829" in other vectors (6)

USD 1,470.00


Availability*
7 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Upf1 (NM_001122829) Mouse Untagged Clone
Symbol Upf1
Synonyms B430202H16Rik; NORF1; PNORF-1; Rent1; Upflp
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>MC223643 representing NM_001122829
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGTGTGGAGGCGTACGGCCCCAGCTCGCAAACACTCACCTTCTTGGACACTGAGGAGGCCGAGCTGC
TCGGCGCCGACACCCAGGGCTCCGAGTTCGAATTCACCGACTTCACCCTTCCCAGCCAGACGCAGACGCC
CCCCGGCGGCCCCGGCGGCGCGGGAGGCCCGGGCGGAGCGGGCGCAGGCGGCGCGGCCGGCCAGCTCGAC
GCACAAGTTGGACCAGAGGGCATCTTGCAAAATGGGGCTGTGGATGACAGTGTGGCCAAGACCAGCCAGC
TGCTAGCTGAGCTGAACTTCGAGGAAGATGAAGAGGACACATACTACACTAAGGACCTCCCAGTCCACGC
CTGCAGTTACTGTGGAATCCATGATCCTGCCTGCGTGGTTTACTGTAATACCAGCAAGAAGTGGTTCTGC
AATGGCCGAGGAAATACTTCTGGCAGCCACATTGTGAATCACCTCGTGAGGGCAAAATGCAAGGAAGTGA
CGCTGCACAAGGACGGGCCTCTGGGCGAGACCGTGCTGGAGTGCTACAACTGTGGCTGCCGCAACGTCTT
CCTGCTGGGCTTCATCCCTGCGAAGGCCGACTCTGTGGTGGTGCTGTTGTGCAGGCAGCCCTGTGCCAGC
CAGAGCAGCCTGAAGGACATCAACTGGGACAGCTCACAGTGGCAGCCCCTAATCCAGGACCGGTGCTTTC
TGTCATGGCTGGTCAAGATTCCCTCTGAGCAGGAGCAGCTGCGAGCACGGCAGATCACGGCACAGCAGAT
CAACAAGCTGGAAGAGCTCTGGAAGGAAAATCCTTCAGCCACTCTGGAGGACCTGGAGAAGCCAGGCGTA
GACGAGGAGCCACAGCACGTGCTCCTGCGTTACGAGGATGCTTACCAGTACCAGAACATCTTCGGGCCAC
TGGTCAAGCTGGAGGCTGACTATGACAAGAAGTTGAAGGAGTCACAGACTCAAGATAACATCACGGTCAG
GTGGGACCTGGGCCTTAACAAGAAGAGAATCGCCTTCTTCACTTTGCCCAAGACTGACTCTGGTAATGAG
GATTTAGTCATAATTTGGTTAAGAGACATGCGGCTCATGCAGGGTGATGAGATCTGTCTGCGGTACAAAG
GGGATCTGGCGCCCCTGTGGAAGGGGATTGGCCACGTCATCAAGGTTCCTGATAATTATGGTGATGAGAT
TGCTATTGAGCTCCGCAGCAGCGTGGGTGCCCCTGTGGAAGTGACCCACAACTTCCAAGTGGATTTTGTG
TGGAAGTCAACCTCTTTTGATAGGATGCAGAGTGCACTGAAGACCTTCGCTGTGGACGAGACCTCTGTGT
CAGGGTATATTTACCACAAGCTGCTGGGCCACGAGGTGGAGGATGTGGTCATCAAGTGCCAGCTGCCAAA
GCGCTTCACAGCTCAGGGGCTCCCTGACCTCAACCACTCTCAGGTGTATGCTGTGAAGACCGTGCTGCAG
AGACCACTCAGCCTCATCCAGGGCCCTCCAGGCACAGGCAAGACTGTGACATCAGCCACTATTGTCTACC
ACCTTGCTCGGCAGGGCAATGGGCCTGTACTGGTTTGTGCTCCAAGTAACATCGCTGTGGACCAGCTCAC
AGAGAAGATCCACCAGACAGGACTGAAGGTCGTACGCCTCTGTGCCAAGAGCCGTGAGGCCATTGACTCC
CCAGTGTCCTTCCTGGCTTTGCACAACCAGATCAGGAACATGGACAGCATGCCTGAGCTGCAGAAGCTGC
AGCAGCTAAAGGATGAGACAGGCGAGCTGTCATCTGCAGATGAGAAGCGGTACCGGGCGCTTAAGCGCAC
AGCTGAGAGAGAACTTCTCATGAATGCAGATGTCATATGCTGCACATGTGTGGGTGCTGGTGACCCGAGG
CTGGCCAAGATGCAGTTCCGTTCCATCCTCATTGACGAGAGCACCCAGGCCACTGAGCCTGAGTGCATGG
TGCCTGTAGTCCTTGGGGCCAAGCAGCTAATCCTCGTCGGTGACCACTGCCAGCTGGGCCCAGTGGTGAT
GTGCAAGAAGGCAGCCAAGGCCGGACTGTCACAATCGCTCTTCGAGCGCTTGGTGGTGCTGGGCATCCGG
CCCATCCGCCTGCAGGTGCAATACCGCATGCACCCTGCACTCAGCGCCTTTCCGTCCAACATCTTCTACG
AGGGCTCATTGCAGAATGGCGTCACTGCAGCGGATCGTGTCAAAAAAGGCTTTGACTTCCAGTGGCCACA
ACCTGACAAGCCTATGTTCTTCTACGTGACGCAGGGCCAGGAGGAGATTGCCAGCTCTGGCACATCCTAC
CTCAACAGGACGGAGGCAGCCAATGTGGAGAAGATAACTACGAAGCTGTTGAAGGCAGGTGCAAAGCCTG
ACCAGATCGGCATCATCACCCCCTACGAGGGCCAGCGCTCTTACTTGGTGCAGTACATGCAGTTCAGCGG
CTCCCTGCACACAAAGCTCTACCAGGAAGTGGAAATTGCCAGTGTGGACGCCTTCCAGGGCCGGGAGAAG
GACTTCATCATTCTGTCCTGCGTGCGCGCCAATGAACATCAGGGCATTGGGTTCCTAAACGACCCCCGGC
GTCTGAATGTGGCTCTCACCAGAGCAAGATATGGCGTGATCATTGTGGGTAACCCAAAGGCCCTGTCGAA
GCAGCCCCTGTGGAATCACCTGCTGAGCTACTACAAGGAACAGAAGGCGCTAGTGGAAGGGCCGCTCAAC
AACCTACGTGAGAGCCTCATGCAGTTCAGCAAGCCTCGCAAACTTGTCAACACTGTCAACCCGGGTGCCC
GCTTCATGACTACTGCCATGTACGATGCCCGTGAGGCCATCATCCCCGGGTCTGTCTATGACCGCAGCAG
CCAGGGCCGGCCCTCGAACATGTACTTCCAGACCCATGACCAGATTAGTATGATCAGCGCAGGCCCCAGC
CACGTGGCTGCCATGAACATCCCTATTCCCTTCAACTTGGTCATGCCTCCCATGCCGCCACCTGGCTACT
TCGGACAGGCCAACGGGCCGGCAGCTGGTCGGGGCACCCCAAAAACCAAGACTGGCCGTGGGGGCCGCCA
GAAGAACCGCTTTGGGCTTCCTGGGCCCAGCCAGACCACCCTTCCCAACAGCCAGGCCAGCCAGGACGTG
GCCTCCCAGCCCTTTTCACAGGGTGCCCTCACACAGGGTTACGTGTCCATGAGCCAGCCCTCTCAGATGA
GCCAGCCTGGCCTCTCCCAGCCAGAACTGTCCCAGGACAGCTACCTCGGTGATGAGTTTAAATCACAGAT
TGACGTGGCACTCTCACAAGACTCCACATACCAGGGAGAGCGGGCATACCAGCACGGCGGGGTCACCGGG
CTGTCCCAGTACTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001122829
ORF Size 3375 bp
Insert Size 3375
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001122829.1, NP_001116301
RefSeq Size 4631
RefSeq ORF 3375
Locus ID 19704
Cytogenetics 8 B3.3|8 34.15 cM

Other Versions

Other products for "Upf1"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones