Pik3cg (NM_001146200) Mouse Untagged Clone

CAT#: MC223554

Pik3cg (untagged) - Mouse phosphoinositide-3-kinase, catalytic, gamma polypeptide (Pik3cg), transcript variant 3, (10ug)

USD 1,401.00


Availability*
6 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Pik3cg (NM_001146200) Mouse Untagged Clone
Symbol Pik3cg
Synonyms 5830428L06Rik; p110gamma; PI3Kgamma
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC223554 representing NM_001146200
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGCTGGAGAACTATGAACAACCGGTGGTTCTAAGAGAGGACAACCTCCGCCGGCGCCGGAGGATGA
AGCCACGCAGCGCAGCAGGCAGCCTGTCTTCCATGGAGCTCATCCCCATTGAGTTCGTACTGCCCACCAG
CCAGCGCATCAGCAAGACTCCAGAAACAGCGCTGCTGCATGTGGCTGGCCATGGCAATGTGGAACAGATG
AAAGCTCAGGTGTGGCTGCGCGCACTGGAGACCAGTGTGGCTGCGGAGTTCTACCACCGATTGGGCCCGG
ACCAATTCCTCCTGCTCTACCAGAAGAAAGGACAATGGTATGAGATCTATGACAGGTACCAAGTGGTGCA
GACCCTAGACTGCCTGCATTACTGGAAGTTGATGCACAAGAGCCCTGGCCAGATCCACGTGGTACAGCGA
CACGTACCTTCTGAGGAGACCTTGGCTTTCCAGAAGCAGCTCACCTCCCTGATTGGCTATGACGTCACTG
ACATCAGCAATGTGCACGATGATGAGCTAGAGTTCACTCGCCGCCGTCTGGTTACGCCCCGCATGGCTGA
AGTGGCTGGCCGGGATGCCAAACTCTATGCTATGCACCCTTGGGTAACGTCCAAACCTCTCCCAGACTAC
CTGTCAAAAAAGATTGCCAACAACTGCATCTTCATCGTCATCCACCGCGGTACCACCAGCCAAACCATCA
AGGTCTCCGCAGATGATACTCCTGGTACCATCCTCCAGAGCTTCTTCACCAAGATGGCCAAGAAGAAGTC
CCTAATGAATATCTCAGAAAGTCAAAGTGAGCAGGATTTTGTATTGCGGGTTTGTGGCCGCGATGAGTAC
CTGGTGGGTGAAACACCCCTCAAAAATTTCCAGTGGGTGAGGCAGTGCCTCAAGAACGGAGATGAAATAC
ACCTGGTGCTCGACACGCCTCCAGACCCAGCCCTTGATGAGGTGAGGAAGGAAGAATGGCCGCTGGTGGA
TGACTGCACTGGAGTCACCGGCTACCACGAGCAGCTGACCATCCATGGCAAGGACCACGAGAGTGTGTTC
ACAGTGTCTTTGTGGGACTGCGACCGAAAGTTCAGGGTCAAGATCAGAGGCATTGATATCCCTGTCCTGC
CTCGGAACACCGACCTCACTGTGTTTGTGGAAGCGAACATCCAGCACGGGCAACAAGTCCTCTGCCAAAG
GAGAACCAGCCCTAAGCCCTTCGCAGAAGAGGTACTCTGGAATGTGTGGCTGGAGTTTGGCATCAAAATC
AAAGACTTGCCCAAAGGGGCTCTATTGAACCTACAGATCTACTGCTGCAAAACCCCATCACTGTCCAGCA
AGGCTTCTGCAGAGACTCCAGGCTCCGAGTCCAAGGGCAAAGCCCAGCTTCTCTATTACGTGAACTTGCT
GTTAATAGACCACCGTTTCCTCCTCCGCCACGGGGACTATGTGCTCCACATGTGGCAGATATCTGGCAAG
GCAGAGGAGCAGGGCAGCTTCAATGCTGACAAGCTCACATCCGCAACCAATCCTGACAAGGAGAACTCAA
TGTCCATTTCCATCCTGCTGGACAATTACTGTCACCCCATAGCTTTGCCTAAGCACCGGCCCACCCCTGA
CCCAGAGGGAGACAGGGTTCGGGCTGAAATGCCCAATCAGCTTCGAAAGCAATTGGAGGCGATCATAGCC
ACAGATCCACTTAACCCCCTCACAGCAGAGGACAAAGAATTGCTCTGGCATTTTCGATATGAAAGCCTGA
AGCATCCGAAGGCTTACCCTAAGCTATTCAGCTCAGTGAAATGGGGGCAGCAAGAAATTGTTGCCAAAAC
GTACCAGCTGTTAGCCAGAAGGGAGATCTGGGATCAAAGTGCTTTGGACGTTGGCTTAACCATGCAGCTC
CTGGACTGCAACTTTTCAGACGAGAATGTCCGGGCCATTGCAGTTCAGAAACTGGAGAGCTTAGAGGACG
ATGACGTTTTACATTACCTTCTCCAGCTGGTACAGGCTGTGAAATTTGAACCGTACCACGACAGTGCGCT
GGCCAGATTCCTGCTGAAGCGTGGCTTGAGGAACAAAAGAATCGGTCACTTCTTGTTCTGGTTCCTGCGA
AGTGAGATCGCACAGTCCAGACACTATCAGCAGAGGTTCGCTGTGATCCTGGAGGCGTACCTGCGAGGCT
GTGGCACAGCCATGTTGCAGGACTTCACACAGCAGGTCCATGTGATTGAGATGTTACAGAAAGTCACCAT
TGATATTAAATCGCTCTCGGCAGAGAAGTATGACGTCAGTTCCCAAGTTATTTCACAGCTTAAGCAAAAG
CTTGAAAGCCTTCAGAACTCCAATCTCCCCGAGAGCTTTAGAGTTCCCTATGATCCTGGACTAAAAGCCG
GTACCCTGGTGATCGAGAAATGCAAAGTGATGGCCTCCAAGAAGAAGCCCCTGTGGCTTGAGTTTAAGTG
TGCTGATCCCACAGTCCTATCCAACGAAACCATTGGAATCATCTTTAAACATGGTGATGATCTGCGCCAA
GACATGTTGATCTTGCAGATTCTACGCATCATGGAGTCCATTTGGGAGACTGAATCTCTGGACCTGTGCC
TTCTGCCTTACGGTTGCATCTCAACTGGTGACAAAATAGGAATGATCGAGATTGTAAAGGATGCCACAAC
GATCGCTCAAATTCAGCAAAGCACAGTGGGTAACACGGGGGCATTCAAAGATGAAGTCCTGAATCACTGG
CTCAAGGAAAAATGTCCTATTGAAGAAAAGTTTCAGGCCGCAGTGGAAAGGTTTGTTTACTCCTGTGCAG
GCTACTGTGTGGCCACATTTGTTCTTGGGATCGGTGACAGGCACAACGACAACATTATGATCTCAGAGAC
AGGAAACCTATTTCATATAGACTTCGGACACATTCTTGGGAATTACAAGAGTTTCCTGGGCATCAATAAA
GAGAGAGTGCCCTTCGTCCTAACCCCAGACTTCTTGTTTGTGATGGGATCTTCTGGAAAAAAGACAAGTC
CACACTTCCAGAAATTCCAGGATGTCTGTGTTAGAGCTTACCTAGCTCTTCGCCATCACACAAACCTGTT
GATCATCTTGTTCTCCATGATGCTGATGACAGGAATGCCCCAGCTGACAAGCAAAGAGGACATTGAATAT
ATCCGGGATGCCCTCACCGTGGGAAAAAGCGAGGAGGACGCTAAGAAATATTTCCTTGATCAGATCGAAG
TCTGCAGAGACAAAGGATGGACTGTGCAGTTTAACTGGTTCCTACATCTTGTTCTTGGCATCAAACAAGG
AGAAAAGCACTCCGCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001146200
ORF Size 3309 bp
Insert Size 3309
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001146200.1, NP_001139672
RefSeq Size 6634
RefSeq ORF 3309
Locus ID 30955
Cytogenetics 12|12 A3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.