Slc4a4 (NM_001136260) Mouse Untagged Clone

CAT#: MC223511

Slc4a4 (untagged) - Mouse solute carrier family 4 (anion exchanger), member 4 (Slc4a4), transcript variant 2, (10ug)

USD 1,391.00


Availability*
6 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Slc4a4 (NM_001136260) Mouse Untagged Clone
Symbol Slc4a4
Synonyms AI835705; NBC; NBC1
Vector pCMV6-Entry
Sequence Data
>MC223511 representing NM_001136260
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGGATGAAGCTGTCCTGGACAGAGGGGCTTCCTTCCTTAAACATGTGTGTGATGAAGAAGAAGTAG
AAGGTCACCACACGATCTACATTGGGGTCCATGTGCCCAAGAGCTACCGGAGAAGGAGACGCCACAAGAG
GAAGGCTGGGCACAAGGAAAAGAAGGAAAAGGAGAGAATCTCCGAGAACTACTCCGACAAATCTGATGTG
GAGAATGCGGATGAGTCCAGCAGCAGTATCCTCAAACCCCTCATCTCCCCGGCCGCAGAACGCATCCGAT
TCATCTTGGGAGAGGAAGATGACAGCCCGGCACCTCCTCAGCTCTTCACGGAACTCGATGAGCTTCTGGC
TGTGGATGGACAGGAGATGGAATGGAAGGAGACAGCGAGGTGGATTAAGTTTGAAGAGAAAGTGGAGCAG
GGTGGGGAGCGATGGAGCAAACCCCATGTGGCCACCTTGTCCCTGCACAGCCTGTTTGAGCTGAGGACAT
GTATGGAGAAAGGATCCATCATGCTTGACCGGGAGGCATCTTCTCTCCCACAGCTGGTGGAGATGATTGC
AGACCACCAGATCGAGACAGGCCTACTGAAGCCTGACCTGAAGGATAAGGTCACCTATACTCTGCTCCGG
AAACATCGACATCAAACCAAGAAATCCAACCTTCGGTCCCTGGCTGACATTGGGAAGACTGTCTCCAGTG
CAAGTAGGATGTTTAGCAACCCTGATAATGGCAGCCCAGCCATGACCCACAGGAATCTGACATCCTCCAG
TCTCAATGACATTTCTGATAAACCAGAGAAGGATCAGCTGAAGAATAAATTCATGAAAAAACTGCCCCGA
GATGCGGAAGCTTCCAATGTGCTTGTTGGGGAGGTTGACTTCTTGGACACTCCCTTCATTGCCTTTGTTC
GCCTACAGCAGGCTGTCATGCTGGGTGCCCTGACTGAGGTCCCTGTGCCCACAAGGTTCTTGTTCATTCT
CTTAGGTCCAAAGGGGAAAGCCAAGTCCTACCATGAGATTGGAAGAGCTATCGCCACCTTGATGTCTGAC
GAGGTGTTCCACGACATCGCTTACAAAGCGAAAGACAGACACGACCTGATTGCTGGCATTGATGAGTTCT
TAGATGAAGTCATTGTCCTTCCACCTGGGGAATGGGACCCCACAATCCGAATAGAGCCTCCAAAGAGTCT
CCCATCATCTGACAAAAGAAAGAATATGTACTCAGGTGGAGAGAATGTTCAGATGAATGGGGACACACCT
CATGATGGAGGCCACGGAGGAGGAGGACATGGTGACTGTGAAGAACTACAGAGAACTGGCCGGTTCTGCG
GTGGATTAATTAAGGACATAAAGAGGAAAGCACCATTTTTTGCCAGTGACTTTTATGATGCTTTAAACAT
TCAGGCTCTCTCTGCGATTCTCTTCATTTATCTGGCAACCGTAACCAACGCCATCACTTTTGGAGGCCTG
CTCGGGGATGCCACCGACAACATGCAGGGTGTGTTGGAGAGTTTCCTGGGCACTGCTGTCTCCGGAGCCA
TCTTCTGCCTTTTTGCGGGTCAACCGCTTACCATCTTGAGCAGCACGGGACCAGTGTTGGTGTTTGAGAG
GCTTCTTTTTAACTTCAGCAAGGACCATAATTTTGACTACTTGGAGTTTCGTCTTTGGATTGGCCTGTGG
TCAGCCTTCATGTGTCTTGTCCTGGTGGCCACTGATGCGAGCTTCCTGGTTCAGTACTTCACCCGTTTCA
CAGAAGAAGGTTTCTCCTCTCTCATCAGCTTCATCTTCATCTATGATGCTTTCAAGAAGATGATCAAGCT
AGCAGATTACTATCCCATCAACTCTGACTTCAAAGTGGGTTACAATACTCACTTCTCTTGTGCTTGCCTG
CCACCCGACCCAGTTAATCTCTCAGTATCTAATGATACCACACTAGCCCCAGAGGACCTGCCGACCATTT
CTTCTACTGACATGTACCATAATGTCACCTTTGACTGGGCCTATTTGTCAAAGAAGGAGTGTGTGAAGTA
TGGAGGGAAGCTCGTGGGAAACAACTGTGACTTCGTGCCTGATATCACACTCATGTCCTTCATTCTCTTC
CTGGGCACTTACACCTCGTCTATGGCTATGAAGAAATTCAAAACCAGTCGCTATTTTCCAACCACAGCAA
GAAAACTGATCAGTGATTTTGCCATTATCCTGTCCATTCTCATATTCTGTGTAATAGATGCCCTAGTCGG
CGTGGACACTCCGAAGCTCATTGTACCAAGTGAGTTCAAGCCAACAAGTCCTAACAGGGGTTGGTTTGTC
CCGCCATTTGGAGGAAACCCTTGGTGGGTGTGCCTTGCTGCTGCCATCCCGGCTTTGCTAGTCACCATCC
TGATTTTCATGGACCAGCAGATCACCGCTGTGATTGTGAACAGGAAAGAGCATAAACTCAAGAAAGGAGC
TGGGTATCACCTGGATCTGTTTTGGGTCGCCATCCTCATGGTGGTATGCTCCTTCATGGCTCTTCCCTGG
TATGTGGCTGCTACTGTTATCTCCATTGCCCACATTGACAGTCTGAAGATGGAGACGGAGACATCTGCGC
CTGGAGAACAACCAAAATTTCTGGGAGTAAGGGAACAACGAGTCACTGGAACCCTTGTGTTTATTCTGAC
TGGCCTGTCAGTCTTCATGGCTCCCATCCTGAAGTTTATCCCGATGCCTGTGCTGTATGGTGTGTTCCTG
TATATGGGGGTGGCCTCACTTAACGGTGTGCAGTTCATGGACCGTCTCAAGCTGCTGCTGATGCCCTTGA
AGCATCAGCCCGACTTCATCTACCTGCGCCACGTCCCCCTCCGCCGAGTCCACCTGTTCACCTTCCTGCA
GGTGTTGTGCCTGGCTCTGCTCTGGATCCTCAAGTCAACAGTGGCTGCAATTATTTTTCCTGTTATGATC
CTGGCCCTGGTAGCAGTCAGAAAAGGTATGGATTACCTCTTCTCCCAGCACGACCTCAGCTTCCTTGATG
ATGTCATTCCAGAAAAGGACAAGAAAAAGAAGGAGGACGAGAAGAAAAAGAAAAAGAAGAAAGGAAGTTT
GGATAGCGACAATGACGATGAGAAAGATCCTCAACATTCCTCGAACGCCACACATCATGCTGATAAAATT
CCTTTCCTTGAGTCGCTGGGTTTACCCAGTCCTCCAAGAACTCCAGTGAAAGTCGTGCCTCAAATTAGAA
TCGAACGTGAGCCTGAAGACAACGATTATCTTTGGAGGAGCAAGGGAACAGAAACCACGTTGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001136260
ORF Size 3285 bp
Insert Size 3285
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001136260.1, NP_001129732
RefSeq Size 7395
RefSeq ORF 3285
Locus ID 54403
Cytogenetics 5|5 E1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.