Ppp1r13b (NM_011625) Mouse Untagged Clone

CAT#: MC223508

Ppp1r13b (untagged) - Mouse protein phosphatase 1, regulatory (inhibitor) subunit 13B (Ppp1r13b), (10ug)

USD 1,391.00


Availability*
6 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Ppp1r13b (NM_011625) Mouse Untagged Clone
Symbol Ppp1r13b
Synonyms AI449786; ASPP1; AW545810; p85; Tp53bp2; Trp53bp2
Vector pCMV6-Entry
Sequence Data
>MC223508 representing NM_011625
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATGCCGATGATATTAACCGTGTTCTTGAGCAACAATGAACAGATTTTAACAGAAGTTCCTATAACAC
CAGAAACCACCTGTCGAGATGTCGTAGAATTCTGCAAGGAACCTGGAGAGGGCGGTTGCCACCTGGCTGA
AGTGTGGAGAGGAAGTGAGCGTCCCATCCCCTATGACCACATGATGTATGAGCACCTGCAGAAGTGGGGG
CCTCGCAGAGAAGAAGTAAAATTTTTTCTTCGTCATGAGGATTCTCCAACTGAGAGCAGTGAACAAGGTG
CCCGTCAGACCCAAGAGCAGAGAACTCAGAGGAGTGTAGTAAATGTACCTGGAGAAAAGCGCACTGAAAA
TGGGGTTGGGAATCCACGTGTTGAACTTACCCTCTCAGAACTTCAAGATATGGCAGCCAGGCAGCAGCAG
CAAATTGAAAACCAGCAGCAAATGTTGGTTGCCAAGGAACAGCGTTTACATTTTCTAAAGCAACAGGAGC
GCCGCCAGCAGCAGTCCGTTTCTGAAAATGAAAAGCTTCAGAAACTGAAAGAGCGAGTTGAAGCCCAGGA
AAACAAGCTGAAGAAGATCCGGGCCATGAGAGGACAAGTTGACTACAGCAAGATCATGAATGGCAATCTG
TCTGCTGAGATAGAAAGGTTCAGTGCCATGTTCCAGGAGAAGAAACAGGAAGTTCAGACTGCAATCTTAC
GAGTTGATCAGCTTAGTCAGCAACTAGAAGATTTAAAGAAAGGAAAACTGAATGGGTTCCAGTCATACAA
TGGCAGGTTGACAGGGCCAGCAGCAGTGGAGTTGAAACGACTCTACCAAGAGCTGCAGATTCGTAACCAG
CTTAATCAGGAGCAGAATTCCAAGCTCCAGCAGCAGAAGGAGCTCTTGAACAAGCGCAACATGGAAGTGG
CCATGATGGATAAGCGGATCAGTGAGCTGCGGGAGCGCCTGTATGGCAAGAAGATCCAGCTGAACCGTGT
GAATGGCACATCGTCACCACAGTCACCCCTGAGCACATCTGGCCGGGTCGCTGCTGTGGGTCCTTATATC
CAGGTTCCCAGTACTGGGGGGTTTCCTCTCCCAGGGGACCCTGTGAAGCCCCAGTCTCTCACCATCGCCT
CAAGTGCTGCCCATGGAAGATCCAAATCTGCTAATGATGGAAACTGGCCACCATTAAAGCAGAATTCTGC
TTCAGTGAAGTCAACTCAGATGACTGGAGACTGGAAGGACTCAGGCATGGAGGGGACCCTAAAGCAAGGT
GCCATCTCAAGCCAGCCTTTGCCTTTGTCAGCACTGGGAGCTACAGAAAAGCTGGGCATCGAGATTGGCA
AAGGGCCACCTCCCATACCTGGTGTGGGCAAGCCACTGCCCCCAAGTTATGGGACATATCCAAGTTCTGG
GCCCTTGGGCCCGGGATCAACAAGCTCTCTGGAGAGGAGGAAAGAAGGAAGCTTGCCCAGACCTGGTGCA
GGCCCACCGAGTCGGCAGAAACCTGCCCCGCTGCCCCCAGCAAGCAACGCTCCCCAGCCTGGCTCCTCAC
AGCAGATTCAGCAGAGGATCTCAGTGCCACCAAGTCCCACATACCCGCCAGCGGGGCCACCTGCCTTTCC
AACTGGAGATGGAAAACCTGAGCTTCCACTCACAGTGGCCATTAGGCCTTTTCTGGCTGATAAAGGGTCA
AGGCCACAATCTCCCAGGAAAGGACCTCAGACAGTAAATTCAAGTTCTATATACTCCATGTACCTCCAGC
AAGCCACACCACCTAAGAACTACCAGCCACCAGCGCATGGCACCTTAAATAAGTCAGTTAAAGCAGTGTA
CGGTAAGCCTGTCCTGCCGTCAGGGTCAGCATCGCCATCACCCTTACCGTTTCTTCATGGGTCACTGGGC
ACAGGCACGGCACAGCCTCAGCCACCTTCAGACTCTGCTGAGAAAGAGCCAGAGCAGGAAGGCCCCAGTG
TACCTGGAGAAGGCAGCACAGTGGAAAGCCTGCCACGGCCGCTCAGTCCCACCAAACTCACACCCATCGT
ACACTCCCCACTCCGTTATCAGAGTGATGCAGACCTGGAAGCTCTCCGCAGGAAGCTGGCCAATGCACCC
CGACCCCTGAAGAAGCGCAGCTCTATCACAGAGCCAGAGGGCCCTGGAGGGCCCAACATTCAAAAGTTGC
TTTACCAACGTTTCAACACCTTGGCTGGTGGAATGGAGGGTACCCCTTTCTACCAGCCCAGCCCTTCCCA
GGACTTTGTGGGCACCTTAGCTGACATGGACAACGGAAACACCAATGCCAATGGCAACTTGGACGAGCCT
TTCCCTCCCCGGCCCACGGCCCCACTTCCTGAGGAGCTTGCCCCTTCCTCAGATGCCAATGATAATGAGT
TACCTTCCCCTGAGCCAGAGGAGCTCATTTGTCCCCAAACAACTCATCAAACTGCTGAGCCCACTGAAGA
CAATAACAACAATGTGGCCCCAGTACCCTCCACAGAACAGATCCCAAGTCCTGTGGCTGAGGCTCCTTCA
GAGGAGGATCAAGTCCCTCCAGCACCTCTTTCCCCCGTCATCCATCCTCCAGCAGCATCCGCGAGCAAAC
GCACCAACCTGAAGAAGCCTAACTCTGAACGGACAGGGCACGGGCTGAGAGTGCGCTTCAACCCCCTAGC
CCTGCTTCTGGACGCTTCTCTCGAAGGAGAGTTTGATCTAGTGCAGAGGATCATCTATGAGGTGGAGGAC
CCTAGCAAACCCAATGACGAAGGGATCACCCCCCTACACAATGCTGTCTGTGCTGGCCACCACCATATCG
TGAAGTTTCTGCTGGACTTTGGTGTCAATGTGAATGCTGCAGACAGTGACGGATGGACACCACTGCATTG
TGCTGCCTCTTGCAACAGTGTCCACCTCTGCAAGCAGCTGGTGGAAAGTGGAGCCGCTATCTTTGCCTCC
ACCATCAGTGACATTGAGACTGCTGCAGACAAGTGTGAAGAGATGGAAGAGGGATACATCCAGTGTTCCC
AGTTTCTGTATGGGGTACAAGAGAAGCTGGGAGTGATGAACAAAGGCACCGTGTATGCTTTGTGGGACTA
CGAGGCCCAGAACAGCGATGAGCTGTCCTTCCATGAAGGGGATGCCATCACCATCCTGAGGCGCAAAGAT
GAAAACGAGACCGAGTGGTGGTGGGCTCGTCTTGGGGACCGGGAGGGCTACGTGCCCAAAAACTTGCTGG
GGTTGTATCCACGGATCAAACCCCGGCAGCGAACACTTGCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_011625
ORF Size 3264 bp
Insert Size 3264
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_011625.1, NP_035755
RefSeq Size 4355
RefSeq ORF 3264
Locus ID 21981
Cytogenetics 12|12 F1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.