C77080 (NM_001033189) Mouse Untagged Clone

CAT#: MC223455

C77080 (untagged) - Mouse expressed sequence C77080 (C77080), (10ug)

USD 1,370.00


Availability*
7 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name C77080 (NM_001033189) Mouse Untagged Clone
Symbol C77080
Synonyms Kiaa1522; mKIAA1522
Vector pCMV6-Entry
Sequence Data
>MC223455 representing NM_001033189
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGCCCGCGCGCCCCCCGCCGCACCTGCGGCCGACGAGCCTGGGAGCCCCGGCGGCCCCCCGCGCA
GGAAGAAGTCCCGCTCCGGCCTCCGCCGTGCCTTCAGCTGGCTGAGGGGCAAACGGCGCAAGAAGAAGGC
GGCCGGGGCCGAGGGCGCCGAGTCCACAGCCTCGCGGGCTAAGAAAGCGGACGACAAGGCCAAGCGGGCC
AAGGGCAAAAGCCGAGGCTCTGCTAAGGCCGAGAGTGACAACCGTCAGGGCGCAGGGCCCAGCCAGGGGC
CAGGATCTGTAGGAGATGAACTTCAGGACAACGTTTTCTTCCCCAGTGGGAGACCTCCTCATCTGGAAGA
GCTGCACACACAGGCCCAGGAGGGGCTCCGCTCCCTCCAGCACCAAGAAAGACAGAAGCTGAGCAAGGGC
GGCTGGGACCATGGAGACACCCAGAGCATCCAGTCCTCCCAGACGGGGCCGGATGAAGATACCATCTCCA
TCTACAGCCAGAAGTCATACATGACGGAGAGCTCCACCGCGGAGGATGCGCTCTCCGTCCGCTCGGAGAT
GATTCAGCGCAGAGGCTCCACCTTCAGACCCCATGACTCATTTCCCAAATCTGGGAAGTCAGGAAGGCGA
CGGAGGGAGCGAAGGAGCACGGTGCTGGGGCTGCCTCAGCACGTGCAGAAGGAGCTCGGCCTGCGGAACA
ACCGTGAGGCACCGGGCACTCCACAGCCTCCTGGTTCACGGGACGCTGTCCGCATCCCCACGGTGGATGG
TCGCCCCGGTCTGGCCTTAGGGACAGGGGTCCGAGTGTCCCTGCAGGCTCTGGAAGCAGAAACAGAGGCC
GGCACAGATGCAGAGGCTGTCATCCAGCGCCACATCGACCGTGTTTACCACGATGACACGCTTGTTGGCC
GATCCACGGGAGCCCGGCCACCGCCACTGACGAGGCCAATGTCTCTCGCAGTGCCTGGACTGACAGGAGG
AGCAGGATCTCCAGAGCCACTGAGCCCAGCCATGTCAATCTCACCCCAGGCCACCTACTTGTCGAAGCTG
ATCCCGCACGCCGTGCTGCCGCCCACCGTGGATGTGGTGGCCCTGGGCCGCAGCAGCCTGCGCACTCTGA
GCCGTTGCAGCCTGCTCTCTGCCAGCCCAGCTTCGGTTCGCTCCCTGGGCCGCTTCTCCTCGGCTTCCAG
TCCACGGCCCCGCAGCCGCAACGCTTCCTCGTCCAGTGACAACTGGAGCCACTCTCAGTCCTCCGAGACC
ATTGTGTCTGATGGTTCCACTCTTTCCTCTAAGGGGGGCTCTGAGGGCCAGCCAGAAGGCTCTGTAGCTA
GCAATAATGTGGCGCCCCCTCCTCCAGGCGGTAGTGGGCGGGGCTCCCCCAGCGGGGGTAGCACTGCGGA
GACCTCAGACACGGCCAGCATCCGAAGCAGTGGGCAGCTGTCTGGCAGGAGTGTGTCCCTGCGTAAGATG
AAACGGCCTCCCCCGCCTCCCCGCCGGACCTACTCCCTCCATCAGCGCGGCTCCGCAGTGCCTGATGGGC
CCTTAGGGTTGCCGCCCAAACCTGAGCGAAAGCAGCAGCCACAGCTGCCTCGGCCGCCCACTGCGGGTGG
CTCTTCAGGGGTGGGGGCAGTATCTTGTCCACCCAGCTCAGCAGGCACCTGGGGCTCTGGCTTGTCCCCA
GGTGGCTCCAGGCGTCCCCCACGTTCCCCAGAACGGACACTTTCACCTTCAAGTGGCTACTCGAGCCAGA
GCGGTACCCCAACTCTCCCTCCCAAGGGTCTGGCAGTTGCCCCTGCTTCCCCAGGCAAGGCTCAGCCCCC
CAAACCAGATCGAGTGACATCCCTTCGATCTCCTGGGGCCTCTGTATCCTCTTCCCTTACATCTCTGTGT
TCCTCTTCTTCAGACCCTACTCCTTTAGACCGCTCTGGCCCACAAATGTCTACCCCCTTGAGTGACAGGT
TCGTCATACCTCCTCATCCCAAGGTGCCTGCTCCTTTCTCTCCACCACCTTCCAAGTCCAAGAGCTCGAA
CCAAGCTGCTCCTGTTCTGGCTGCCCCTGCTGTGGCTCCTGGGCAGGTGTCCACCATCGACACCAGTCCT
GCATCCCCTTCCATGCCCCAGACAACCTTGACTCCAGCCCAGGAGTCTCCTGTTGCCTCCAAAGATGAGT
CACCCCCACCATCCCCACCCCCATCTTACCATCCACCCCCACCACCTACTAAGAAGCCGGAGGTGCTGGA
GGAGGCCCCACCTCCTCCGGAAGCTGCTGTGGAGATCCTTCCAGATCCCAGCTGGCCGCCGCCACCACCA
CCTGCACCTGAGGAACAGGACCTGTCGATGGCTGACTTCCCCCCTCCTGAGGAGGTCTTCTTCAATGCAG
GCCCTGAGCTTGGCCCTCTGGAGTCCTGCAGCTCTGAGGCTGCCGTCCCCCCAGCTGCTAGCTTGTCCCA
GACTCCTCCGCCAGCTCCACCTCCTAGTTCTGGATCAGAACCTCTGGCCAGGCTCCCACAGAAGGACTCA
GTGGGCAAGCACAGCGGGGCTCCCAGGGAGGATTCGGGCACGCCTCTGGTCACACCCTCGCTCCTGCAGA
TGGTCCGGCTTCGCTCTGTGGGTGCTTCCACAGGGATTCCGAACCCTTCTCCGGGTTCATCGGCCCCTCA
GAAGCCTCTGCGAAGAGCCCTGTCTGGGCGCGCCAGCCCAGTGACTGCTCCCTCCTCTGGGCTCCATGCT
GCCGTCCGACTCAAGGCCTCTAGCCTGGCTGCCAGTGAGAGTCCTGCGAGTGCTCTGCCCACTGGAATAC
CCGAGGCAGAGCCACGGTCGCCACAGTCTCCTGCCTCCAAGGCCAGCTTCATCTTCTCCAAGGGCACCAA
AAAACTGCAGCTGGAGAGGCCCGTGTCCCCCGAGGCCCAGGCTGACCTCCAGCGGAATCTGGTGGCTGAA
CTTCGGAGCATTTCAGAGCATCGGCCACCTCCCCAGGCCCAGAAGAAGCCTTCCAAGGCTCCCCCACCAG
TGGCCCGCAAACCCTCAGTGGGAGTCCCTCCTCCGTCCCCCAGTCTTCCCAGGACGGAGTCTCTTACTGC
TCCATCCACCAATGGGCTCCCTCACGCTGAGGACAGGACTAACGGGGAGCTGGCGGAGAATGGAGGTGTG
CAGCTGGCTGCTACAGAGAAGATGGGCTCCCCTGGTTCAGATCCACAGAAGAAACTGGTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001033189
ORF Size 3213 bp
Insert Size 3213
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001033189.3, NP_001028361
RefSeq Size 5187
RefSeq ORF 3213
Locus ID 97130
Cytogenetics 4|4 D2.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.