Farp1 (NM_134082) Mouse Untagged Clone

CAT#: MC223377

Farp1 (untagged) - Mouse FERM, RhoGEF (Arhgef) and pleckstrin domain protein 1 (chondrocyte-derived) (Farp1), (10ug)

USD 1,339


Availability*
6 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Farp1 (NM_134082) Mouse Untagged Clone
Symbol Farp1
Synonyms AW228844; BC030329; Cdep
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC223377 representing NM_134082
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGAGAAATAGAGCAGAAGCCCACCCCAGCATCACGTCTGGGGGCCCCAGAGAACTCGGGGATCAGCA
CCTTGGAACGAGGACAGAAACCACCGCCCACACCTTCAGGAAAACTTATGACTGTCAAAATTCAGATGCT
GGACGACACCCAGGAGGCCTTTGAAGTTCCACAACGAGCGCCAGGGAAGGTTCTGTTTGACGCCGTGTGC
AACCACCTCAACCTTGTGGAGGGCGACTACTTCGGCCTGGAGTTCCCTGACCACAGGAAGATCGTGGTGT
GGCTGGATCTCCTGAAGCCCATTGTGAAGCAGATTCGAAGACCGAAGCACGTCGTTGTTAAATTTGTTGT
GAAATTCTTCCCTCCCGACCACACACAGCTCCAGGAAGAACTTACCAGGTACCTGTTCGCTCTGCAGGTG
AAGCAGGACTTGGCTCAAGGCAGGCTGACGTGTAACGACACCAGTGCCGCTCTCTTGATCTCACACATTG
TACAGTCGGAGATTGGGGATTTCGATGAAGCTTTGGACAGAGAACACTTAGCAAAAAATAAGTACGTACC
TCAACAGGATGCGCTGGAAGACAGAATCATGGAGTTCCACCACAGCCACGTTGGACAAACCCCGGCAGAG
TCAGATTTCCAGCTCCTAGAGGTGGCCCGTCGGCTAGAGATGTACGGAATCCGGTTACACCCTGCCAAGG
ACAGGGAAGGCACCAAGATCAACCTGGCTGTCGCCAACACTGGAATTCTAGTGTTTCAGGGCTTCACGAA
GATCAATGCTTTTAACTGGGCCAAGGTGCGGAAGCTGAGCTTCAAGCGGAAGCGCTTTCTTATCAAGCTC
AGACCTGACGTGAATAGCTCATACCAGGACACCTTGGAGTTCCTGATGGCCGGCCGAGACTTCTGCAAGT
CTTTCTGGAAAATATGTGTGGAGCACCATGCCTTCTTCAGACTCTTCGAAGAACCTAAGCCAAAGCCAAA
GCCTGTTCTCTTCAGCCGAGGGTCGTCCTTCCGGTTTAGTGGTCGGACTCAGAAGCAAGTTCTTGATTAT
GTTAAAGAAGGCGGCCACAAGAAGGTGCAGTTTGAAAGAAAGCACAGCAAGATCCACTCCACCAGGAGCC
TGGTCTCACAGCCCACAGCACCGAATTCAGAAGTGCCAAAACAGTCTCCACAGAGCGCAAGCCTTACGTT
TGGAGAAGGTACCGAGTCTCCGGGTGGCCAGAGCTGCCAGCAAGCGAAGGAAACAAAAGCCTGTACCTTG
GAGTTGGGACCTCACCAAAGCCCCGCCCTCCCTAAGAGCCCTCCAGGGAGCAAAGCTGCAGATGGAACCA
CCGTGGTGCCGCCTGAGGAAGAAGAGGAGGAAGAGGGTGGCAAGGACGGCATCCGGCCAAGTAACCCTCA
GCCCCCGCAGCCAAGCACAGGCTCCCTGACTGGTAGCCCTCACCTTTCAGAGCTGTCCATCAACTCACAG
GGAGGAGCCGCCCCAGCCAACGTGACCCTGTCTCCCAACCTGAGTCCTGACAACAAGCAGGCCTCTCCCC
TGATCAGCCCGCTCCTGAACGACCAAGCGTGCCCAAGGACCGACGACGAAGAAGAGGGCCGGCGAAAGAG
ATTCCCAACCGACAAGGCGTACTACATTGCTAAGGAAGTCTCCACCACAGAGCGCACGTACCTGAAGGAC
CTTGAGGTCATTGCTTCGTGGTTTCAGAGCACAGTCAGCAAAGAGGACTCCATGCCCGAAGCCTTGAAGA
GTCTCATATTCCCAAATTTTGAACCTTTGCACAAGTTCCATACCAATTTTCTGAAGGAAATTGAGCAACG
ACTTGCCCTGTGGGAAGGCCGCTCAAATGCCCACGTCAGAGGAGATTACCAAAGAATCGGGGACGTCATG
CTGAAAAACATTCAGGGCATGAAGCACCTGGCGGCCCACCTGTGGAAGCACAGTGAGGCCCTGGAGGCCC
TGGAGACCTCCATCAAGGGCTCGCGGCGGCTGGAACATTTCTGCCGAGACTTCGAGCTGCAGAAGGTGTG
TTACCTGCCGCTCAACACCTTCCTCCTGCGCCCGCTGCACCGGCTCATGCACTATAAGCATGTCCTGGAG
AGGCTGTGCAAGCACCACCCACCAAACCACGCCGACTTCAGGGACTGCAGAGCTGCGCTGGCGGAGATCA
CAGAGATGGTGGCACAGCTGCATGGTACCATGATCAAGATGGAGAACTTCCAGAAGCTGCATGAGCTCAA
GAAAGATCTGATCGGCATTGACAATCTTGTGACCCCAGGAAGGGAGTTCATCCGCCTGGGCAGCCTCAGC
AAGCTCTCCGGGAAGGGGCTTCAGCAGCGCATGTTCTTCCTGTTCAACGATGTCTTGCTGTATACCAGCC
GGGGACTGACGGCATCTAATCAGTTTAAAGTCCACGGACAGCTCCCACTCTATGGCATGACGATCGAGGA
GAGTGAGGAGGAGTGGGGTGTGCCCCACTGCCTGACCCTGCGGGGCCAGCGGCAATCTATCATCGTGGCT
GCCAGTTCCCGGTCAGAGATGGAAAAATGGATGGAGGACATCCAGATGGCCATTGACCTGGCAGAGAAAA
GCAATGGACCCACCCCCGAGCTCCTTGCCAGCAGCCCCCCTGACAACAAGTCCCCGGATGAAGCCACAGC
GGCTGACCAGGAGTCAGAGGATGACCTGAGTGCCTCTCGGACATCGCTGGAGCGCCAGGCCCCTCACCGT
GGCAACACGATGGTGCACGTGTGCTGGCATCGCAGCACCAGTGTCTCCATGGTGGACTTCAGCATTGCTG
TGGAGAACCAGCTCTCTGGGAACTTGCTGAGAAAGTTCAAGAACAGCAATGGCTGGCAGAAGCTGTGGGT
GGTATTCACCAACTTCTGCCTGTTCTTCTACAAATCACACCAGGACAGTCACCCCCTTGCCAGCCTGCCT
CTGCTGGGCTACTCCCTCACCATCCCCTCTGAGTCTGAGAACATCCACAAGGACTATGTGTTCAAGCTGC
ATTTCAAGTCCCACGTGTACTACTTCAGGGCTGAAAGCGAATACACATTTGAAAGGTGGATGGAAGTGAT
CCGAAGTGCCACCAGCTCAGCCTCTCGGGCCCACATCTTGAGTCACAAAGAATCTCACCTGTACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_134082
ORF Size 3147 bp
Insert Size 3147
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_134082.3, NP_598843
RefSeq Size 4857
RefSeq ORF 3147
Locus ID 223254
Cytogenetics 14|14 E5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.