Tbc1d9 (NM_027758) Mouse Untagged Clone

CAT#: MC223281

Tbc1d9 (untagged) - Mouse TBC1 domain family, member 9 (Tbc1d9), transcript variant 2, (10ug)

  View "NM_027758" in other vectors (6)

USD 1,360.00


Availability*
6 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Tbc1d9 (NM_027758) Mouse Untagged Clone
Symbol Tbc1d9
Synonyms 4933431N12Rik; AI847101; AW490653; C76116
Vector pCMV6-Entry
Sequence Data
>MC223281 representing NM_027758
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTGGGTGAATCCGGAGGAGGTACTGCTGGCCAACGCGCTGTGGATCACCGAGAGAGCCAACCCCTACT
TCATTCTGCAACGAAGGAAGGGCCACGGGGGCGACGGGGGTGGCGGCGGCGGATTGGCGGGCCTCCTTGT
GGGTACCCTCGATGTGGTATTGGACTCCAGTGCCCGAGTCGCACCGTACCGAATCCTTTATCAAACTCCA
GACTCTCTAGTCTATTGGACCATTGCCTGTGGTGGCTCCAGGAAGGAGGTTACTGAGCACTGGGAATGGC
TTGAACAGAACCTACTGCAGACACTCTCCATCTTTGAGAATGAGAATGACGTCACCACATTTGTAAGAGG
GAAAATACAGGTAACCATCGTGGAGAAGGCCGACAGCTGCAGTGTGCTCCCCAGCCCTCTGTCCATCAGC
ACCAGGAACAGGATGACCTTCCTGTTCGCGAACTTGAAAGACAGAGACTTTCTGGTGCAGAGGATCTCAG
ATTTCTTGCAGCAAACGACTTCTAGGATCTACTCAGACAAAGAGTTTTCAGGAAGCTGCAACAGCTCAGA
TGATGAGGTGTATTCTCGGCCCAGCAGCCTCGTTTCCTCCAGTCCCCAGAGAAGCACAAGCTCGGATGCT
GATGGAGAACGCCCCTTTAACCTCAATGGCAACAGTGTCCCTACAGCCACCCAGACCCTCATGACCATGT
ACCGGCGGCGATCTCCTGAAGAATTCAACCCAAAATTGGCCAAAGAGTTTTTGAAAGAACAAGCCTGGAA
GATTCACTTTGCTGAGTATGGGCAGGGAATCTGCATGTACCGCACAGAGAAGACCCGGGAGCTGGTGCTG
AAGGGCATCCCAGAGAGCATGCGCGGAGAGCTCTGGCTGCTGCTTTCAGGGGCCATCAATGAAAAGGCCA
CACACCCCGGGTACTACGAGGGCCTCGTGGAGAAGTCGATGGGAAAGTACAATCTGGCCACCGAGGAGAT
TGAGAGAGACTTACACCGCTCCCTTCCAGAACACCCAGCTTTCCAGAACGAAATGGGCATCGCGGCTCTG
AGGAGAGTCTTAACGGCTTATGCTTTTCGCAATCCCAACATAGGATACTGCCAGGCCATGAACATTGTCA
CTTCAGTGCTACTGCTGTATGCCAAAGAGGAGGAGGCCTTCTGGCTGCTTGTGGCCTTGTGTGAGCGCAT
GCTTCCCGACTACTACAACACCAGAGTTGTAGGTGCCCTGGTGGACCAGGGAGTCTTCGAGGAGCTGGCT
CGAGACTATGTCCCGCAGCTGTACGACTGCATGCAGGACCTGGGGGTGATCTCTACCATCTCCCTGTCGT
GGTTCCTCACACTCTTCCTCAGTGTGATGCCATTTGAGAGTGCAGTGGTGGTTGTGGACTGTTTCTTCTA
TGAAGGAATCAAAGTGATATTTCAGCTGGCTCTCGCTGTACTGGATGCCAACGTGGATAAACTCTTGAAC
TGCAAGGACGATGGAGAGGCCATGACTGTTTTGGGAAGGTACCTAGACAGTGTGACCAACAAAGACAGCA
CCCTGCCTCCCATCCCCCATCTCCACTCCCTGCTCAGTGACGACGTGGGGCCCTACCCTGCCGTGGACAT
CTTCAGACTCATAGGGACGTCTTACGAGAAATTTGGAACTATCCGGGCCGATTTGATTGAGCAGATGCGA
TTCAAGCAGAGGCTGAAAGTGATCCAGACCCTGGAGGACACCACCAAACGCAATGTGGTACGGACCATTG
TGACGGAGACGTCCTTCACCATCGATGAGCTGGAAGAACTGTACGCTCTTTTCAAGGCTGAGCATCTGAC
CAGCTGCTACTGGGGTGGGAGCAGCAATGCCCTGGACCGACACGACCCCAGCCTGCCTTACCTGGAGCAG
TACCGCATCGACTTTGAGCAGTTCAAGGGCATGTTCGTGCTGCTCTTTCCCTGGGCGTGTGGCACACACT
CCGATGTGCTGGCCTCCCGCCTGTTCCAGCTGTTAGATGAGAATGGAGACTCCTTGATTAACTTCCGAGA
GTTCGTCTCTGGGCTGAGTGCTGCATGCCATGGGGACCTCACAGAGAAACTCAAACTCCTGTACAAGATG
CACGTCTTGCCTGAGCCATCCTGTGATCAAGATGAGCCTGACTCCGCCTTTGAAGCCACTCAGTACTTTT
TTGAAGACATCACCCCAGAATGCACACATGTTGTTGGCTTGGACAGTAGAGGCAAGCAGAGTGCGGACGA
CGGCTTCGTCACAGTGAGCCTGAAGCAGGACAGAGGGAAAAGGGCAAATTCTCAAGAAAACCGTAATTAC
CTAAAACTCTGGACTGCAGAAAATAAGTCTAAGTCAAAAACTGCCAAGGATTTGCCCAAGCTGAACCAGG
GGCAGTTTATTGAGCTCTGTAAGACCATGTACAACATGTTCAGTGAAGACCCCAATGAGCAGGAGCTGTA
CCATGCCACAGCTGCGGTGACCAGCCTCCTGCTGGAGATCGGAGAGGTTGGCAAGTTCTTCATTACTCAG
CCGGCAAAGGAAGATGCAGTTCCTGGACCACCCTGCGGCCAGGCCATCCCAGGCATGCTCTTCCCTAAGA
AGGGGTCCAGCCAGTCCTATGTGGTGGAGTCCACAGAGCCACTCACAGCTAGCCTGGCAGTGGACAGTGA
GGAGCACTCCCTGGGAGGGCAGATGGAGGACATTAAACTGGAGGACTCCTCACCCAGGGACAACGGGGCC
TGCTCCTCCATGTTGATCTCCGATGATGACACCAAGGATGACAGCTCCATGTCATCCTACTCGGTGCTGA
GCGCCGGCTCCCACGAGGAGGACAAACTGCACTGTGAGGACATTGGAGAGGACACAGTCCTGGTGCGTAG
CAGTCAGGGTAGAGCCACCCTGCCCAGGAGCAGCAGCCTGGACCGGGACTGGGCCATCACCTTTGAGCAG
TTCCTGGCCTCGCTCTTGACGGAGCCCGCTCTCGTGAGGTACTTTGACAAGCCAGTGTGCATGATGGCCA
GGGTCACCAGTGCGAAGAACATCCGTATGATGGGCAAGCCCCTCACCTCAGCCAGTGACTATGAAATCTC
TGCCCTGTCGGGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_027758
ORF Size 3096 bp
Insert Size 3096
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_027758.4, NP_082034
RefSeq Size 5149
RefSeq ORF 3096
Locus ID 71310
Cytogenetics 8|8 C2
Gene Summary May act as a GTPase-activating protein for Rab family protein(s). [UniProtKB/Swiss-Prot Function]
Transcript Variant:

Other Versions

Other products for "Tbc1d9"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones