Arhgef10 (BC059212) Mouse Untagged Clone

CAT#: MC223132

Arhgef10 (untagged) - Mouse Rho guanine nucleotide exchange factor (GEF) 10 (cDNA clone MGC:66545 IMAGE:6400425), (10ug)

USD 1,278.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Arhgef10 (BC059212) Mouse Untagged Clone
Symbol Arhgef10
Synonyms 6430549H08
Vector pCMV6-Entry
Sequence Data
>BC059212
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAAAATCCAGAGGAAGCAATTTACGACGACGTTCCGAGGGAAAACTCGGACTCTGAGCCAGATGAAA
TGATTTATGATGATGTGGAGAACGGCGAAGAAGGTGGAAACAGCTCCCCAGAGTACGGGTGGAGTTCCAG
CGAATTCGAAAGCTATGAGGAGCCAAGCGACTCGGAGGGCAAGAACGGAATTCCCAGGTCCTTCCTGCGC
AGCAGTCATAAAAAGCAAATGCAGAAGCTTATGAAGGCAGCCAAGGAGGGCACCAAAGATGGGCTGGAGA
AAACCAAAGCTGCTGTGAAGAGAGGCGGCTCCTTCATCAGGACCAGGTCCTTGGTCTCTCAAGATCACAG
GTGTTATTTTGAAGAAGAGCAGAATTTGTTCATTGACGTGGACTGCAAGCACCCGGAGGCTGTCCTCACC
CCAATGCCCGAGGGCTTGTCTCAGCAGCAGGTTGTGAGAAGATACATTCTGGGCTCCATTGTTGAGAGCG
AGAAGAACTATGTAGATGCTCTCCGGAGGATTTTGGAGCAATATGAGAAGCCGCTGTCTGAGATGGAGCC
CCGGCTCCTGAGTGACAGGAAGCTCAGGATGGTTTTCTACCGCGTCAAGGAGATCCTGCAGTGTCACTCC
ATGTTCCAGATTGCGCTGGCCAGCCGCGTGTCCGAGTGGGATGTCGTGGAAACAATCGGCGACGTTTTTG
TGGCCTCGTTCTCCAAGTCCATGGTGCTGGATGCTTACAGCGAGTACGTGAACAACTTCAGCACGGCCGT
GGCTGTCCTCAAGAAGACGTGTGCCACAAAGCCTGCTTTCCTTGAGTTCTTAAAGCTGAGCCAGGATTCC
AGTCCAGACCGAGTCACACTCCACAGCCTTATGATGCGGCCCATCCAGAGGTTCCCACAGTTCATCCTCC
TACTGCAGGACATGCTGAAGAACACCGCCAAAGGACATCCTGACAGGCTGCCCCTTCAGATGGCGCTGAC
GGAGCTCGAGACCCTGGCAGAGAAGCTAAACGAGAGAAAAAGAGATGCCGACCAGCGATGCGAAATCAAA
CAAATAGCAAAAGCCATAAACGAGAGATACCTGAACAAGCTCCTCAGCAGTGGAAACCGGTACCTCGTCC
GGTCCGATGACGTCATCGAGACGGTTTACAACGACCGGGGAGAAATCGTCAAGACCAAACAACGCCGGAT
CTTCATGCTGAATGACGTGCTCATGTGTGCCACCGCCAGCTCACGGAACTCACATGAAAGCCATGCCGTG
ATGAGCCAGAGGTACCTGCTCAAGTGGAGTGTCCCTCTAGGTCACGTGGATGTGATTCAGTACAATGGAG
GCTCTGGCGCCGGGGAGCACTGTCGGCACCACGCTGCACACTCACCTGAGAGCCTGGCCGTGGTGGCCAA
CGCGAAGCCACACAAAGTTTACATGGGGCCAGGGCAGCTGTACCAGGATCTGCAGAACCTACTGCACGAC
CTGAACGTTGTTGGCCAGATCTCGCAGCTGATAGGAAACCTCCGAGGGAGCTATCAGAACTTAAACCAGT
CTGTAGCCCATGATTGGACGTCGGGCTTACAGCGGCTGATACTGAGGAAAGAAGATGCGATCAGAGCTGC
CGACCGCTGCCGGATCCAGTTACAGCTCCCGGGAAAGCAGGACAAGTCCGGGCGGCCCACGTTCTTCACT
GCTGTGTTCAATACGCTTACACCAGCCATCAAGGAGTCCTGGGTCAGCAGCCTGCAGATGGCCAAGCTGG
CCCTTGAGGAGGAGAACCATATGGGATGGTTCTGTGTGGATGACGATGGCAACCTAGCCAAGAAGGAGAC
ACACCCTCTCCTGGTGGGACACATGCCTGTGATGGTGGCCAAGCAGCCAGAGTTCAAGATTGAATGTGCA
GCTTATAACCCTGAACCTTACCTGAGCAATGAAAGTCAACCAGCCTCACCCTCCACAGCCCGTGGCTTTC
TGTGGATTGGAAGCTGTAGCAACCAGATGGGTCAGGTCGCCATTGTCTCCTTCCAAGGTTCCAACCCCAA
AGTCATCGAGTGCTTCAATGTGGAATCACGCATCCTGTGTATGGTATACATTCCCGCAGAGGAGTCAAAG
CCCCAAGAAACCACCGAAACCAAGGATCCAGAAGCCACAGCCTCGAGAGCACCCCATGTGCCCACCATCT
GCCTGGGCACAGAAGAGGGAAGCATTTCCATTTACAAAAGCAGTCAGGGCTGCAAGAAGGTGAGGCTTCA
GCACTTCTATGCACCGGACAAGTCCACGGTCATGAGCTTGGCCTGCTCCCCACAAGGCCTGTATGCAGGC
CTGGTCAATGGGTCCGTAGCCAGCTACACCAAGGCTCCAGATGGATCCTGGAACTCGGAACCCCAGCAAG
TGATCAAGTTGGGTGTCCTGCCAGTCAGAAGCCTTCTCCTGGTGGAGGGTGCACTGTGGGCAGCCTCGGG
AGGGCAGGTGTTCATGGCCAGCGTGGAGACTCACACTATAGAGAATCAGCTGGAGGCCCACCAAGATGAA
GGGATGGTCATCTCCCACATGGCTGTGGCTGGCGTTGGCATCTGGATTGCCTTCACCTCGGGGTCCACCC
TCCGCCTCTTCCACACAGAGACCTTGAAGCACCTGCAGGATGTCAACATTGATGCCCCTGTGCATAGCAT
GCTGCCAGGGCACCAGCGTCTATCTGTGACCAGCCTGCTCGTCTGCCACGGCTTGCTCATGGTCGGTACC
AGCCTGGGTGTCGTGGTGGCCCTGCCAGTCCCTCGGCTTCAGGGTATCCCCAAAGTGACAGGGCGAGGCA
TGGTCTCCTACCATGCGCATAACGGGCCCGTTAAGTTCATCGTCTCAGCCACGGCGTTTCAAAACAAGGA
CAGAGCCAGGGACAGCCCACGTTCCGGTTCTGAGCTTCAGGATGAAGACCCCAAGGACTTGCTCTGCAGC
GAGGAAGGTCCTTCCTGCCCGGGCCAGCCTGACACCTACACATCCGTTTGGTTGGGAGACTCCCTAGGAT
TGCCAACTCAAAAGAATGATCTGTCTTCGTCCTCGGGGTCACTGAACCTGTCCCATGGCTCCAGTTCCCT
AGAGCACAGATCTGTGGACAGCAGTCTGTGTGACCTGCTGAGGGACCCCAGTGCCTCCCCAAGGAGCAGA
CCACAGGGCTCTAGGCGAGCAAGAGCCAGTTCAGCGCTGGTGGTATGTGGGGGCCAGGGCCACCGGCGGG
TGCACAGGAAGGCCAGGCAGCCTTCTCAGGAGGACCTGGTTTCTTCAGTGATGGTGTGGCAGATCCCCCT
GCTGGGCATGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN BC059212
ORF Size 3303 bp
Insert Size 3303
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC059212,
RefSeq Size 4065
RefSeq ORF 3303
Locus ID 234094
Cytogenetics 8|8 A1.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.