Patj (NM_001005784) Mouse Untagged Clone

CAT#: MC222891

Inadl (untagged) - Mouse InaD-like (Drosophila) (Inadl), transcript variant 2, (10ug)

USD 1,247.00


Availability*
5 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Patj (NM_001005784) Mouse Untagged Clone
Symbol Patj
Synonyms Cipp; Inadl
Vector pCMV6-Entry
Sequence Data
>MC222891 representing NM_001005784
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCTGAAAACCCTGCTGCAGAGAAGATGCAGGTCCTGCAGGTCCTGGATCGCCTTCGAGGGAAGCTGC
AGGAGAAGGGAGACACGACGCAGAACGAGAAGCTGTCTGCGTTCTACGAGACGCTGAAGAGCCCTCTCTT
CAACCAGATCCTTACACTGCAGCAGTCCATCAAGCAGCTGAAGGGACAGCTTAGCCACATCCCCTCAGAT
TGCTCAGCCAACTTTGACTTTTCTCGCAAGGGCTTGCTAGTGTTCACGGATGGTTCCATTACAAACGGGA
ATGCCCAAAGGCCTTGTAGTAATGTGACTGCATCTGAACTGTTGCCCTGGACTCAAAAGTCAGCAAGTGA
AGACTTTAACTCAGTCATTCAGCAGATGGCTCAGGGCCGGCACGTTGAGTATATAGATATTGAACGTCCT
TCAACTGGAGGCCTTGGATTCAGTGTGGTGGCTCTGAGAAGCCAAAGCCTGGGATTAATTGATATCTTTG
TGAAGGAAGTCCATCCCGGGAGTGTAGCAGACAGGGATCACAGATTGAAGGAAAATGACCAGATTTTGGC
CATTAATGACACCCCATTGGATCAGAATATTTCCCATCAGCAGGCGATTGCATTACTACAACAAGCCACT
GGATCTCTGCGGCTGGTTGTGGCCAGGGAAGTGGGCCACACACAGGGCCGAGCATCCACCAGCTCAGCTG
ATACAACTCTGCCAGAAACGGTGTGTTGGGGCCACACGGAAGAGGTTGAGCTCATTAACGATGGCTCTGG
ATTAGGTTTTGGGATAGTTGGAGGGAAATCCAGCGGCGTGGTCGTGAGGACTATTGTTCCTGGAGGACTG
GCAGACCGAGATGGAAGACTGCAGACAGGGGATCACATCTTGAAGATTGGTGGTACAAATGTTCAAGGGA
TGACCAGTGAACAAGTTGCTCAAGTGCTAAGGAACTGTGGGAATTCAGTGAGGATGCTGGTGGCCAGAGA
CCCTGTTGGTGAAATTGCAGTAACACCTCCTACCCCTGTATCCTTACCTGTTGCCCTACCTGCTGTAGCC
ACAAGGACCCTTGATTCTGACAGGTCTCCTTTTGAAACTTACAGTGTTGAACTTGTTAAGAAAGATGGGC
AGAGTCTTGGGATTAGAATTGTTGGCTATGTTGGAACAGCTCATCCAGGGGAAGCTTCCGGGATTTATGT
GAAAAGTATAATTCCAGGCAGCGCTGCATACCACAATGGCCAAATTCAAGTGAATGATAAAATCGTGGCT
GTGGATGGTGTGAATATTCAAGGTTTTGCTAATCAGGATGTTGTCGAAGTATTGCGGAATGCTGGGCAGG
TGGTACACCTGACCCTTGTTCGAAGGAAAACATCTTTATCTGCTTCTCCGTTTGAGCACTCTTCAAGCAG
AGAAACTGTTGCAGAACCACCTAAAGTACCAGAACGAGCAGGATCCCCGAAACCAGAAGCTAATTTGAGT
GTGGAAGCAGAGGAAATTGGAGAAAGACTGGATAATCTAAAAAACAACACTGTACAAGCCTTAGAAAAAC
CAGATGTATATCCAGAGAAAGTTCCAGGCTCTCCAGAAAATGAGCTGAAATCCAGATGGGAAAACCTACT
GGGCCCAGATTATGAAGTAATGGTAGCCACTTTGGATGCTCAGATTGCAGACGATGAGGAGCTACAGAAA
TACTCGAAGCTGCTGCCTATCCACACGCTCAGGCTTGGGATGGAAGTCGACTCCTTCGATGGGCACCACT
ATATCTCCTCAGTTGCTCCTGGGGGTCCTGTGGATACCCTGAACCTCCTTCAGCCAGAGGATGAACTTCT
TGAGGTCAACGGCATGCAGCTTTATGGGAAGTCTCGCCGAGAAGCAGTCTCCTTCCTTAAAGAAGTGCCC
CCACCATTTACCTTGGTCTGCTGCCGCCGGCTGTTTGATGATGAGGCCTCAGTTGATGAGCCAAGAACCA
TGGAGCCTGCTCTTCTTGAGGCCGAGGTTGACCACAGTGTAGATGTCAACATTGAAGATGATGATGATGG
AGAATTAGCCCTGTGGTCTCCTGAAGTCAAGACTGTGGAGCTGGTGAAAGACTGCAAAGGCTTAGGATTC
AGTATTTTGGATTATCAGGACCCCCTGGATCCCACGCGGTCAGTGATTGTGATTCGCTCCTTGGTGGCAG
ATGGTGTAGCGGAAAGAAGTGGAGAACTTTTACCTGGAGATCGCCTAGTCTCCGTCAATGAGTTCTCCTT
GGACAATGCCACTCTTGCTGAGGCTGTGGAAGTGTTGAAGGCTGTACCCCCAGGTGTGGTGCATCTTGGC
ATCTGTAAGCCTTTGGTGGAAGATGAGAAGGAAGAGCGTTTTAGTTTACATTCAAACAACAATGGTGACA
GCAGCGAGCCTGCAGACGCTGTTCATGAGATCCACTCATCTTTAATCCTTGAGGCACCCCAGGGATTTAG
AGATGAGCCATATCTTGAAGAACTCGTGGATGAACCTTTTCTAGATTTGGGAAAGTCTTTGCAGTTCCAA
CAAAAAGACGTGGACAGCAGCTCGGAAGCTTGGGAAATGCATGAGTTCCTGAGTCCTCCGCTGGACGGCA
GGGGTGAGGAGAGAGAGATGCTTGTCGATGAGGAGTATGAACTTTATCAAGATCACCTCCGGGCCATGGA
GTCAAACCCACCACCACCACACATTCGGGAGGCCGCTCCTGCATCTCCCGTGCTGGAACTCCAGGCTGGT
ACACAGTGGCTGCATGCTAACCTCTCAGGAGGCGAAAGGCTGGAGTGTCACGATGCAGAGTCCATGATGA
GTGCCTATCCCCAGGAGATGCAGCAGTATAGCTACAGCACTGCAGACATGGTACGGCTTTGCGACACAGC
CACCACCTGCTCCCCGCTCTGCCCCCACACCCCTCGCTCATGTTACTTCCATTCATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001005784
ORF Size 2928 bp
Insert Size 2928
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001005784.1, NP_001005784
RefSeq Size 3335
RefSeq ORF 2928
Locus ID 12695
Cytogenetics 4|4 C6
Gene Summary This gene encodes a multivalent PDZ domain protein, which is expressed exclusively in brain and kidney. This protein selectively interacts with inward rectifier K+ (Kir) family members, N-methyl-D-aspartate receptor subunits, neurexins and neuroligins, as well as cell surface molecules enriched in synaptic membranes. Thus, this protein may serve as a scaffold that brings structurally diverse but functionally connected proteins into close proximity at the synapse. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (2) lacks multiple 3' exons but has an alternate 3' segment, as compared to variant 1. The encoded isoform (2) has a much shorter and distinct C-terminus, as compared to isoform 1. COMPLETENESS: complete on the 3' end.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.