Dnajc6 (NM_001164584) Mouse Untagged Clone

CAT#: MC222740

Dnajc6 (untagged) - Mouse DnaJ (Hsp40) homolog, subfamily C, member 6 (Dnajc6), transcript variant 2, (10ug)

USD 1,195.00


Availability*
5 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Dnajc6 (NM_001164584) Mouse Untagged Clone
Symbol Dnajc6
Synonyms 2810027M23Rik; mKIAA0473
Vector pCMV6-Entry
Sequence Data
>MC222740 representing NM_001164584
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACAAATCCAAAGTCAGGGGTTGCAGAGTCAGCCGGACTTGCCTGCTCTCGTGCAGCAGCGGGAGAAA
ACAGAATGAAAGATTCTGAAAATAAAGGTGCCTCGTCTCCAGACATGGAGCCCAGCTATGGGGGAGGCCT
TTTTGACATGGTGAAAGGCGGTGCAGGGAGGCTATTCAGTAACCTGAAGGACAACTTGAAAGACACTCTC
AAAGATACATCCTCCAGGGTCATCCAGTCTGTTAGCAGCTACACAAAGGGAGACCTAGACTTTACTTACG
TCACCTCCAGGATTATCGTGATGTCCTTTCCTGTGGATAGTGTTGACATAGGATTCAGGAATCAGGTTGA
TGACATCCGTAGCTTTTTGGATTCCAGACATCTTGACCACTACACAGTATACAACTTGTCACCCAAGTCT
TACCGAACTGCCAAGTTCCACAGCCGGGTCTCAGAGTGCAGTTGGCCCATCAGGCAGGCTCCAAGTCTAC
ACAACCTGTTTGCTGTGTGTAGGAATATGTATAACTGGCTACTGCAGAACCCCAAAAATGTCTGTGTTGT
CCACTGCTTGGATGGACGGGCCGCGTCGTCAATCCTGGTTGGTGCTATGTTCATTTTCTGTAATCTCTAC
TCCACGCCTGGCCCTGCTGTTCGATTACTCTACGCAAAGCGACCAGGAATTGGACTGTCTCCGTCTCACA
GGAGGTACTTAGGCTACATGTGCGACCTACTTGCAGATAAGCCCTACCGCCCTCACTTCAAGCCACTCAC
GATCAAGGCAATCACTGTCAGCCCAGTTCCCTTCTTCAATAAGCAGAGAAATGGGTGCCGCCCTTACTGT
GACGTTCTGATTGGAGAAACTAAAATATATTCAACGTGCACAGACTTTGAACGAATGAAAGAATACCGTG
TCCAAGATGGGAAAATCTTCATCCCTCTGAACATCACAGTCCAAGGTGATGTCATCGTTTCCATGTACCA
CTTGCGGTCAACCATCGGGAGCCGGCTGCAGGCGAAGGTGACCAACACACAGATATTCCAGCTCCAGTTT
CATTCTGGGTTTATACCACTGGACACGACAGTTTTAAAGTTCACCAAGCCTGAGCTGGATGCATGTGATG
TACCAGAAAAATATCCTCAGCTGTTCCAAGTGACACTGGATATAGAAGTCCAGCCCCAAGACAAAGTGAT
CGACTTAACTCCACCATGGGAACACTACTGCACAAAAGATGTGAACCCCAGCATCCTCTTCTCCTCTCAG
CAGGAGCATCAGGACACTCTGGCCTTAGGGGGTCAGGCTCCAGCCGATCTCCCACCAGACCATCCCAGGA
ATCTTGGGCAAGGAGGCTTCTTTGCCTCTCTCTGTTGGCAAGATCAGAAATCAGAGAAGTCACGCTGTGA
GGAGGACCACGCTGCCCTGGTGAATCAGGAAAGTGAGCAGTCAGATGATGAGCTACTGACTCTCTCCAGC
CCCCATGGCAATGCAGAGGGTGATAAGCCTCATGGAGCCAAGAAGCCAGGCAAAAAGCAGCAGGAGCCAG
CTGCGCCTCCTCCCCCAGAGGAAGTGGACCTCCTGGGCCTGGAAGGGTCTGATGTGAGCACGAACTTCTC
TTCCTTGGCAGCTCCTCCCAGCAATTCTGAGTTGCTGAGTGACCTGTTTGGGGGTGTAGGTGCCACAGGT
CCTGCTCAGGCAGGACAGGCTGGGGTAGAAGATGTGTTTCATCCTAGTGGACCTGTGTCTGCACAGTCCA
CACCGCGCCGAACCGCCACCTCCGCCTCTGCATCGCCAACCCTAAGAGTGGGAGAAGGTGCCACCTTTGA
CCCTTTTGGAGCCCCTGCTAAGCCACCAGGTCAGGATTTGTTGGGCTCCTTTCTAAACACATCCAGTGCT
TCTAGCGACCCCTTTCTGCAGCCCACGAGAAGCCCTTCCCCTACAGTGCATGCTTCTAGTACTCCTGCTG
TGAACATCCAGCCCGACATTGCTGGAGGTTGGGACTGGCACACCAAACCAGGAGGTTTTGGAATGGGGAG
CAAATCCGCTGCCACCAGCCCGACAGGCTCATCACATGGCACCCCCACCCATCAGAGCAAGCCCCAGACT
CTGGATCCCTTCGCTGACCTGGGGACACTAGGTAGCTCTTCATTTGCCAGCAAACCTACCACCCCAACTG
GATTGGGTGGAGGATTTCCACCTCTCAGCTCACCACAGAAAGCATCCCCCCAGCCAATGGGTGGAGGGTG
GCAGCAGCCAGCCGGCTACAACTGGCAGCAGACACAGTCTAAGCCACAGTCCAGTATGCCTCACTCCTCC
CCTCAGAACCGACCCAATTACAACGTGAGCTTCTCGGCTATGCCTGCAGGGCAGAGCGAACGTGGAAAAG
GATCTACTAACTTGGAAGGGAAACAAAAGGCTGCTGACTTTGAAGATCTGCTTTCTAGTCAAGGCTTCAA
TGCACACAAAGACAAAAAGGGGCCTCGAACAATAGCTGAGATGAGAAAGGAGGAGATGGCTAAGGAAATG
GATCCTGAAAAACTAAAGATCCTGGAGTGGATAGAGGGCAAAGAGAGAAACATCAGAGCTCTGCTTTCCA
CAATGCACACCGTGCTGTGGGCTGGGGAGACCAAATGGAAACCCGTGGGCATGGCGGATCTGGTGACGCC
GGAGCAAGTGAAGAAGGTGTACAGGAGGGCTGTGCTAGTGGTGCACCCTGACAAGGCAACTGGGCAACCC
TATGAACAATACGCAAAGATGATTTTCATGGAGCTAAATGATGCCTGGTCTGAATTTGAAAACCAAGGCC
AAAAGCCCTTGTATTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001164584
ORF Size 2817 bp
Insert Size 2817
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001164584.1, NP_001158056
RefSeq Size 5165
RefSeq ORF 2817
Locus ID 72685
Cytogenetics 4|4 C6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.