Filip1l (NM_001177871) Mouse Untagged Clone

CAT#: MC222433

Filip1l (untagged) - Mouse filamin A interacting protein 1-like (Filip1l), transcript variant 2, (10ug)

  View "NM_001177871" in other vectors (6)

USD 1,170.00


Availability*
5 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Filip1l (NM_001177871) Mouse Untagged Clone
Symbol Filip1l
Synonyms 4631422O05Rik; Doc1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>MC222433 representing NM_001177871
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTGGTGGATGAACAACAACGGCTTACAGCTCAACTCGCCCTTCAAAGACAGAAAATCCAAGCTCTGA
CCACAAGTGCAAAGGAAACACAGGGTAAACTAGCCCTTGCTGAGGCCAGAGCTCAGGAAGAAGAGCAGAA
GGCAACCAGACTAGAAAAAGAACTGCAGACACAGACCACAGAGTTTCACCAAAACCAAGACAAAATTATG
GCGAAGCTCACCAATGAGGACAGTCAAAATCGCCAGCTCCGACAGAAGCTGGCAGCACTCAGTCGGCAAA
TTGATGAGTTAGAAGAGACCAACAGGTCTTTAAGAAAAGCCGAGGAAGAGCTGCAGGATATAAAAGACAA
AATAAACAAGGGAGAATATGGAAACTCTGGCATCATGGATGAAGTGGATGAGCTCAGGAAGCGCGTGCTG
GACATGGAAGGGAAAGATGAAGAGCTCATAAAAATGGAGGAGCAGTGCAGAGACCTCAATAAGAGGCTAG
AGAAAGAGACAGTACAGAGTAAAGACTTCAAACTAGAGGTTGACAAACTTAGTGTAAGGATCACAGCTCT
GGAAAAATTAGAAGATGCTTTAGACAAAAGCAAACAAGAATGCTACTCTCTGAAATGCAATTTAGAAAAA
GAAAAGATGACCACAAAGCAATTGTCTGAAGAGCTGGAGAGTTTAAATGCCAGAATCAAAGAGCTAGAAG
CCATTGAAAGTCGGCTAGAAAAGACAGAAATCACACTAAAGGATGATTTAACTAAACTGAAAACTTTAAC
TGTGATGCTTGTAGATGAACGCAAAACAATGAGTGAAAAATTAAAGCAAACAGAAGATAAGTTACAAAGC
ACCACCTCTCAGCTCCAAGCAGAGCAAAATAAAGTAACAACAGTGACTGAGAAGTTAATTGAGGAAACCA
AGAGGGCACTCAAGTCCAAAACTGATGCAGAAGAGAAGATGTACAGTGTAACCAAGGAGAGAGATGACCT
CAGAAATAAACTGAAAGCAGAAGAAGAGAAAGGACATGATCTCTTGTCAAAAGTTACTATATTGAAAAAC
AGGCTTCAGTCACTGGAAGCAATTGAGAAAGATTTTGTAAAAAACAAATTAAACCAAGACTCCAGTAAGT
CCACAGCAGCATTACACCAAGAAAACAATAAGATTAAAGAGCTCTCTCAAGAAGTGGAAAATCTGAAACT
GAAGCTAAAGGATATGAAAGCCATTGAGGATGACCTCATGAAAACAGAGGATGAGTACGAGACCTTAGAA
CGGAGGTATGCTAACGAGAGAGACAAGGCTCAGTTTCTGTCTCAGGAGCTGGAACATGCCAAGATGGAGC
TTGCCAAGTACAAGTTGGCCGAGAAGACAGAGTCCAGCCACGAGCAGTGGCTCTTTAGGAGGCTCCAGGA
AGAAGAAGCAAAATCAGGGCACCTGTCCAGAGAAGTGGATGCATTAAAAGAGAAAATTCATGAGTACATG
GCCACAGAGGACCTAATATGTCACCTCCAAGGAGACCACTCCCTTCTGCAAAAGAAACTAAACCAACAAG
AAAACAGGAACAGAGATTTGGGAAGAGAGATTGAAAACCTCACTAAAGAGTTAGAAAGGTATAGGCACTT
TAGTAAGAGCCTCCGGCCTAGTCTCAACGAAAGAAGAATCTCTGACCCGCAAGTATTTTCTAAAGAAGTT
CAAACGGAAGCAGCAGACAGTGAGCCACCAGACTACAAGAGCCTCATTCCTCTGGAAAGAGCAGTGATCA
ATGGTCAGTTCTATGAGGAGAATGAGGACCAGGATGACGACCCTAATGAGGAGGAGTCTGTGCTGTCCTT
CAGATGCAGCCAGTCTTCTTCTCTTCCTATGAACAGGAAACTATGGATTCCCTGGATGAAATCCAAGGAG
GGCCATCCTCAGAATGGAAAAATACAAACTAAGTCCAATGGCAACTTTGTACAACCTGGAGATCTTGTTC
TAAGTCACACACCTGGGCAGCCACTTCACATAAAGGTTACTCCAGACCACATTCAAAATACAGCTACTCT
TGAAATCACAAGTCCAACCACAGAGAGTCCTCACTCCTACACCAGCACAGCGGTGATACCAAACTGTGGC
ACCCCAAAGCAAAGGATTACCATTCTCCAAAATGCCTCTATAACACCAATTAAGTCCAAAAGCTCTACAG
AAAGCCTTATGAACTTAGAGCAAAGCATGTCCCCAGTTACCATGGCAACCTTTGCCAGAGCACAGACCCC
AGAGTCCTGTGGTTCTGTGACTCCAGAACGGACAATGTCACCTATTCAGGTTTTGGCTATGACTGGTTCA
CCTAGTTCTCCTGAGCAAGGCTGCTCCCCAGAGCCGATAGAAATCAGCGCCAAGCATGCAATTTTCAGAG
TCTCCCCAGACCGGCAGTCATCATGGCAGTTTCAACGTTCAAACAGTAACAGCTCAAGTGTGATAACTAC
TGAGGATAATAAAATCCACATTCACTTAGGAAGTCCTTACATGCAAGCTGTGGCTGGCCCCATGAGACCT
GCCAGCCCTTCAGCACCACTGCAGGATAACAGAACTCAAGGCTTAACTAATGGGGCACTAAACAAAACAA
CCAATAAAGTCACCAGCAGTATTACTATCACACCAACAGCCACACCTCTTCCTCGACAATCACAAATTAC
AGTAAGTAATATATATAACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001177871
ORF Size 2682 bp
Insert Size 2682
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001177871.1, NP_001171342
RefSeq Size 3253
RefSeq ORF 2682
Locus ID 78749
Cytogenetics 16|16 C1.1

Other Versions

Other products for "Filip1l"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones