Dcaf6 (NM_028759) Mouse Untagged Clone

CAT#: MC222333

Dcaf6 (untagged) - Mouse DDB1 and CUL4 associated factor 6 (Dcaf6), (10ug)

USD 1,113.00


Availability*
5 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Dcaf6 (NM_028759) Mouse Untagged Clone
Symbol Dcaf6
Synonyms 1200006M05Rik; Iqwd1; PC326
Vector pCMV6-Entry
Sequence Data
>MC222333 representing NM_028759
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTCGGAGTGGCTCCTGCCCGCACCTGTTGTGGGACGTGAGGAAAAGGTCCCTTGGGCTGGAGGACC
CGTCCCGGCTGAGGAGCCGCTACCTGGGAAGAAGAGAATTTATCCAAAGATTAAAACTTGAAGCAACTTT
AAATGTGCATGATGGCTGTGTTAATACAATCTGTTGGAATGACACTGGAGAATATATTTTATCTGGCTCT
GATGACACTAAACTTGTAATTAGTAATCCATACAGCAGAAAGGTTTTGACAACCATCCGTTCAGGGCATC
GAGCAAATATATTTAGTGCAAAGTTTTTGCCGTGCACAGATGATAAGCAGATTGTGTCTTGCTCTGGAGA
TGGAGTCATATTTTATACTAACATTGAGCAAGATGCAGAAACTAACAGACAGTGCCAATTTACGTGCCAT
TATGGAACTACTTATGAGATTATGACTGTACCAAACGACCCTTACACCTTTCTGTCCTGTGGTGAAGATG
GAACTGTTAGGTGGTTTGACACACGCATCAAAACCAGTTGCACAAAAGAAGACTGTAAAGATGATATTTT
AATCAACTGTAGGCGTGCTGCCACATCTGTGGCTATTTGTCCCCCAGTACCATATTACCTTGCTGTGGGT
TGTTCTGACAGCTCAGTACGGATTTATGATCGGCGAATGCTGGGCACAAGAGCTACAGGGAATTATGCAG
GCCGAGGAACTACTGGAATGGTTGCTCGATTTATACCTTCTCATCTTAGTAACAAATCATGCAGAGTGAC
ATCACTGTGTTACAGTGAAGATGGTCAAGAGATTCTTGTCAGTTATTCTTCAGACTACATCTATCTTTTT
GACCCCAAAGATGATACTGCACGAGAACTTAAAACTCCTTCTGCAGAGGAGAGGCGAGAAGAGTTACGAC
AGCCTCCAGTTAAGCGCTTGAGACTTCGTGGTGATTGGTCAGATACTGGTCCCAGAGCACGGCCAGAAAG
TGAACGAGAACGAGATGGAGAGCAAAGTCCCAATGTGTCACTGATGCAGAGAATGTCTGATATGTTATCA
AGGTGGTTTGAAGAAGCAAGTGAAGTTGCACAAAGCAACAGAGGAAGAGGAAGACCTCGGCCCAGAGGTG
GAACAAATCAGCCAGATGTTTCAACTCTTCCTACGGTTCCATCAAGTCCTAATTTGGAAGTGTGTGAAAC
TGCAATGGATGTAGACATGCCAGCTGCACTTCTTCAGCCTTCTACATCCTCTACAGATCCAGTTCAGGCT
CAGGCAGCCACAGCCGCCATAGAAAGCCCTCGTTCCAGCTCGTTGCTGTCTTGCCCAGACAGTGAACCGA
GGCAGTCTGTTGAGGCGTCTGGACACCATGCACATCATCAGTCAGATAACAGTAATGAGAGGCTGAGCCC
CAAACCAGGGACAGGTGAACCCGTTTTAAGTTTGCACTACAGCACAGAAGGAACAACTACAAGCACAATA
AAACTGAACTTTACAGATGAATGGAGCAGTACAGCCTCAAGTTCCAGAGGAAATGGGAGCCATTGCAAAT
CTGAGGGTCAGGAAGAATGCTTGGTCCCTCCGAGCTCTGTGCAGCCACCGGAAGGAGACAGTGAAACAAG
AGCTCCTGAAGAACTATCAGAGAAAGGAACACTTCCAGAAAACCTCACTCAAAACCAGATAGATACAGCA
CAACTTGATAACTTCCCAGCTGAGCCATTGGATTCTAACTCAGGAGAGAAGAATAACCCAAGTCAGGACA
GCCCTTGTGGGCTTCCAGAAGAAGGCACTTTGTCTGAAACAGACAGGGAGACTTGTGAGCAGGCCAGCAC
TGAGAGTGCTACCAGGCATGCTAGCACCAAGCCTGAACTCCCATCCCAGACAGAAGCCATTGAGCAGGCC
AGCACTGAGAGTGCTACCAGGCATACCAGTGCCAATCCTGAACTCCCATCCCAGACAGAAGCCATAGCAC
CTTTAGCTCATGAAGACCCATCTGCCAGGGACTCTGCTCTCCAGGACACAGATGACAGCGATGATGATCC
GGTCTTGATCCCTGGTGCAAGATACCGAACAGGACCTGGTGATAGACGCTCCGCTGTTGCCCGCATTCAG
GAGTTCTTCAGGAGGAGAAAAGAAAGGAAAGAAATGGAAGAGCTGGATACTTTGAACATTAGGAGGCCAC
TAGTAAAGATGGTTTATAAGGGCCACCGCAACTCCCGGACAATGATAAAAGAAGCCAATTTCTGGGGTGC
TAACTTTGTAATGAGCGGTTCCGATTGTGGCCATATCTTCATCTGGGACCGGCACACTGCTGAGCATTTG
ATGCTTCTGGAAGCTGATAATCATGTGGTCAACTGCCTGCAGCCCCATCCGTTTGACCCAATTCTAGCCT
CATCTGGCATAGATTATGACATAAAGATCTGGTCGCCACTAGAAGAGTCAAGAATTTTTAATCGAAAACT
TGCTGATGAAGTTATAACTCGGAATGAACTCATGCTGGAAGAGACTCGGAACACCATCACCGTCCCAGCC
TCTTTCATGTTGAGGATGTTGGCGTCACTGAATCATATCCGAGCTGACCGTCTGGAGGGTGACAGATCAG
AAGGTTCAGGTCAGGAGAATGAAAATGAGGATGAAGAATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_028759
ORF Size 2631 bp
Insert Size 2631
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_028759.1, NP_083035
RefSeq Size 3306
RefSeq ORF 2631
Locus ID 74106
Cytogenetics 1|1 H2.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.