Csf2rb2 (NM_007781) Mouse Untagged Clone

CAT#: MC222306

Csf2rb2 (untagged) - Mouse colony stimulating factor 2 receptor, beta 2, low-affinity (granulocyte-macrophage) (Csf2rb2), (10ug)

USD 1,113.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Csf2rb2 (NM_007781) Mouse Untagged Clone
Symbol Csf2rb2
Synonyms AIC2A; BetaIl3; Bil3; Csfgmrb; Il3r; Il3rb; Il3rb2
Vector pCMV6-Entry
Sequence Data
>MC222306 representing NM_007781
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACCAGCAAATGGCACTCACATGGGGGCTGTGCTACATGGCACTGGTGGCTCTCTGCTGGGGACACG
AGGTGACAGAGGAAGAAGAAACGGTCCCTCTGAAGACTCTGGAGTGCTACAATGACTACACCAACCGTAT
CATCTGCAGCTGGGCAGACACAGAGGATGCCCAGGGGCTAATCAACATGACCCTCCTCTATCACCAGCTA
GACAAGATTCAATCAGTGTCCTGTGAGCTCAGTGAGAAACTCATGTGGTCAGAGTGCCCGTCATCCCACC
GCTGTGTGCCCAGAAGATGTGTCATCCCCTACACACGATTTTCTAATGGAGATAACGACTACTACTCCTT
CCAGCCAGATCGTGACCTGGGCATCCAGCTCATGGTCCCACTGGCCCAGCATGTGCAGCCACCCCCTCCC
AAGGACATCCACATCAGCCCCTCTGGGGATCATTTCCTGCTGGAATGGAGTGTATCTCTTGGGGATTCCC
AGGTCTCCTGGCTTTCATCAAAGGACATAGAGTTTGAGGTGGCTTATAAGCGGCTTCAGGACTCCTGGGA
GGATGCCTCCAGTCTCCACACTAGCAACTTTCAGGTGAATTTAGAGCCAAAGCTATTCCTACCCAACAGC
ATCTATGCTGCCCGTGTGCGCACTCGGCTGTCCGCGGGTTCAAGCTTGTCTGGGAGACCCAGCAGATGGA
GCCCAGAGGTTCACTGGGACTCCCAGCCAGGGGACAAGGCCCAGCCACAGAACCTTCAATGCTTCTTTGA
TGGGATCCAGTCTCTCCACTGCTCCTGGGAGGTGTGGACCCAGACGACTGGCTCTGTTTCCTTTGGGCTC
TTCTATCGCCCCAGCCCTGCAGCTCCGGAGGAGAAATGCTCTCCGGTGGTGAAGGAGCCGCAGGCCAGCG
TCTACACCCGCTACCGCTGCAGTCTACCTGTGCCTGAGCCCAGTGCACACAGCCAGTACACAGTCTCTGT
TAAGCACCTGGAACAAGGGAAGTTCATCATGAGCTATTACCACATCCAGATGGAACCTCCAATCCTCAAC
CAGACCAAGAACAGAGACAGCTACAGCCTGCATTGGGAAACTCAGAAAATACCCAAATACATTGATCACA
CTTTCCAGGTCCAGTACAAGAAGAAGTCAGAGAGCTGGAAGGACAGCAAGACAGAAAACCTAGGTCGAGT
CAATAGCATGGACCTGCCCCAGCTGGAGCCGGACACCTCATACTGCGCCAGGGTGAGGGTCAAGCCCATC
TCTGACTACGACGGGATCTGGAGCGAGTGGAGCAATGAGTACACTTGGACGACTGACTGGGTGATGCCCA
CGCTGTGGATAGTCCTCATCCTGGTCTTTCTCATCTTCACCTTGCTCCTGGCTCTCCACTTTGGCCGTGT
TTATGGGTACAGGACATACAGGAAGTGGAAGGAAAAGATCCCCAACCCCAGCAAGAGCCTCCTGTTCCAG
GATGGAGGTAAAGGTCTCTGGCCTCCTGGCAGCATGGCAGCCTTCGCGACTAAGAACCCCGCTCTCCAGG
GGCCACAGAGCAGGCTTCTTGCTGAGCAACAGGGGGTGTCATATGAACATTTGGAAGACAACAACGTGTC
ACCTCTCACTATAGAGGACCCTAATATAATTCGAGATCCACCATCCAGGCCTGATACAACCCCAGCTGCC
TCATCTGAATCCACAGAGCAACTTCCCAATGTTCAAGTAGAGGGACCAATTCCTTCTAGCCGACCCAGGA
AGCAATTACCCAGCTTTGACTTCAATGGGCCCTACCTGGGGCCTCCCCAATCCCACTCCCTGCCTGATCT
CCCAGGCCAGCTGGGTTCTCCCCAGGTGGGTGGGAGCCTGAAGCCAGCACTGCCAGGCTCCTTGGAGTAC
ATGTGTCTGCCCCCTGGAGGTCAAGTGCAACTGGTCCCATTGTCCCAGGTGATGGGACAGGGCCAGGCTA
TGGATGTGCAGTGTGGGTCCAGCCTGGAGACCACAGGGAGCCCTTCCGTGGAGCCAAAGGAGAACCCTCC
AGTTGAGCTGAGCGTGGAGAAACAGGAGGCAAGGGACAACCCAATGACTCTTCCCATAAGCTCTGGGGGC
CCTGAGGGCAGTATGATGGCCTCTGATTATGTCACTCCTGGAGATCCGGTGCTCACTCTGCCCACAGGGC
CCCTGTCTACCTCTCTGGGCCCCTCTCTAGGGTTGCCCTCAGCCCAAAGCCCCAGTCTCTGTCTTAAGCT
GCCCAGGGTCCCCTCTGGAAGCCCAGCTCTAGGGCCACCAGGGTTTGAGGACTATGTGGAGCTGCCTCCA
AGTGTGAGCCAGGCAGCCACGTCCCCTCCAGGCCATCCTGCTCCTCCTGTGGCAAGCAGCCCCACAGTGA
TCCCAGGAGAGCCCAGGGAGGAAGTGGGCCCAGCATCCCCACATCCCGAAGGCCTCCTTGTTCTTCAGCA
GGTTGGGGACTACTGCTTCCTCCCTGGCCTGGGACCTGGCTCCCTCTCACCACACAGTAAGCCACCCTCT
CCAAGTCTGTGTTCTGAGACTGAGGACCTAGACCAGGACTTGTCTGTGAAAAAGTTTCCCTATCAACCCT
TGCCCCAGGCCCCAGCCATTCAGTTTTTCAAGTCCCTAAAGTATTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_007781
ORF Size 2637 bp
Insert Size 2637
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_007781.2, NP_031807
RefSeq Size 4619
RefSeq ORF 2637
Locus ID 12984
Cytogenetics 15 E1|15 37.22 cM
Gene Summary In mouse, there are two classes of high-affinity IL3 receptors. One contains this IL3-specific beta subunit and the other contains the beta subunit also shared by high-affinity IL5 and GM-CSF receptors. [UniProtKB/Swiss-Prot Function]
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.