Vmn2r111 (NM_001104573) Mouse Untagged Clone

CAT#: MC222178

Vmn2r111 (untagged) - Mouse vomeronasal 2, receptor 111 (Vmn2r111), (10ug)

USD 1,092.00


Availability*
5 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Vmn2r111 (NM_001104573) Mouse Untagged Clone
Symbol Vmn2r111
Synonyms EG210876; V2rp2
Vector pCMV6-Entry
Sequence Data
>MC222178 representing NM_001104573
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTCACCTTGATTTTCCTCTTCTTGCTACTGAACATTCCACTTCTTGTGGCTGATTTTATTCATCCCA
GGTGCTTTTGGAAAATGAAGCGGAATGAAAACAAGGATAGAAACCAGGGAACAGGATGTACCTTTGTGAT
TCATGCAGTACAACAACCTGTGGAAAAAGAGTATTTTAGTCATATATTGAATATACAAACTCAGACTGAA
AATCGCAAATATGCTCTGGCTTTGGCTTTTTCCATAAATGAAATCAACAGGAACCCTGATCTTTTGCCAA
ATATGTCTCTAATATTTAAATTCTCAGCACACAATTGTGTCTGGGAATCTGAAATAATGAATCTTATGCT
TTTGAGTTTACAAAATTATGATATTTTCCCTAATTATTTGTGTAAAGAATACACCAAATGTGCAATGGCC
CTTACAAACCTGAATTGGGCAACAACTGTGACACTTTATACAATCCTGAATAACATCATTTCTGAGCAGT
TCCTTCAGATTACTTATGGACCCTTTCATCCTGTCCTGAGTGATCATGAAAAATTTCCCTATCTACATCA
GATGGCCTCTGATCATACATCTCTAGCACTTGCCCTGGTATCCTTCATAATTCATTTTGGTTGGAACTGG
GTAGGGTTGGTCATCTCAGACAGTGATCAAGGTATCCAATTTCTCTCCTATTTGAGAAGAGAGATGGAAA
AATACACAGTGTGCTTTGCCTTTGTCAACATGATTCCAGTCAACATGAATTTATACATGTCAAGAGCTGA
AGTGTATTACAACCAAATCATGACATCATCCACAAATGTTGTCATCATTTATGGTGACACCGACAGTACA
TTAGCTGTGAGCTTTAGAATGTGGGAATCCCTAGGTATACAGAGACTATGGATCACCACCTCACAGTGGG
ATGTCAGTCCTAGAATGAAAGACTTTACATTTGGTAACAAATATGGGACTTTTGATTTTCAACAACACAA
TAGTGAGATTTCTGGTTTCAAAAATTTTGTGCAGACATTGAACTCTGTCAAATACCCAGATGACTATCTG
GTAGAGCTGGAATGGATGCACTTTAACTGTGAGGTCTCAGCATCTAAATGTAAGACACTGAAGAACTGCT
CATCCAATCACTCATTGGAATGGTTAATGGTACATACTTTTGACATGGCTTTTATTGAAAAGAGTTATTA
CATATACAATGCTGTGTATGCTTTTGCCCATGCACTCCATCAGTTTACTTTTCAAAAGTTTGATAATCTG
CCCAAGGACAATGGGAAAGAACACAATTATAGCTGCAAGAAGGTGGATCCCTCTCTGAGAAAGATGCAGT
TCACTAATCCTGTTGGGGACATAGTGAATATGAACCAAAGAGACAAACTGCAGGAAGAGTATGACATTTT
CTACATTTGGAATTTCCCACAGGGCCTTGGACTTAGAGTTAAAATAGGGATGTTTAGTCCCTATCTTCCA
AATGGTCAACAGGTACATTTATCTGAAGTTATAATAAAGTGGACAAAAGGAAGTACACAGGTGCCAACTT
CTGTGTGCAGTGCTGATTGTGGTCCTGGATCTAGAAAATTTGGGATGGATGGAATGGCAGCATGCTGTTT
TCATTGCAAACCATGCCCAGAAAATGAAATTTCTAATGAGACAAATGTGGATAATTGTGCCCAGTGTCCA
GAGGACCAATATGCTAACACAGAACAGAATCACTGCATTCATAAAGCTGTTGTATTTCTCAACTATGAAG
AACCACTGGGGATGGCACTTTCCTTATTCTCCTTGTGCTTCTCTGCATTCACAACTGTGATTCTCGGGGT
CATTGTGAAGCACCACAATACTCCAATTGTTAAGGCCAATAACAGGACTCTCACCTACATCTTGCTCATC
TCACTCATTTTTTGTTTCCTCTGTCCCTTGCTCTTCATTGGCCATCCAAACTCAGTCACCTGCATTCTAC
AACAAATCACATTTGGAGTTGTATTCACTGTTGCTCTCTCCACTGTCTTAGCTAAAACAATTGTTGTAGT
TCTGGCATTCAAAATCACAGCCTCTCAAAGAATGATGAAGTACTTTCTAGTTTCAGGGGCATCTAACTAC
ATCATTCTCATTTGTACTCTCATCCAAGTTATTGTATGTGCAGTTTGGCTGGGAGCTTCTCCTCCTTCTG
TTGATATTGATGCTCAATCTGAACATGGCCACATCATCATTGTTTGCCACAAGGGTTCAGTCAATGCATT
TTACTCTATTCTGGGATACTTGGCTCTCCTGTCCTTTGGGAGCTTCACTCTGGCTTTCCTTTCCAGAAAC
CTTCCTGGTGCCTTTAATGAAGCCAAATCCATAACATTCAGCATGCTGGTGTTCTGCAGTGTCTGGGTCA
CTTTCATCCCTGTTTACCATAGCACCAAAGGCAAGGTCATGGTGGCTGTGGAGATCTTCTCCACTTTGGC
TTCCAGTGCAGGGATGCTGGGGTGCATCTTTGTTTCTAAATGTTATACAATATTGTTTAGACCAGACCGA
AATTCTGTTGAAATGACCAGGGTGAAATCATCTTTCCATGCTCGTGTTTCATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001104573
ORF Size 2574 bp
Insert Size 2574
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001104573.1, NP_001098043
RefSeq Size 2574
RefSeq ORF 2574
Locus ID 210876
Cytogenetics 17|17 A3.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.