Prom2 (NM_138750) Mouse Untagged Clone

CAT#: MC221960

Prom2 (untagged) - Mouse prominin 2 (Prom2), transcript variant 1, (10ug)

USD 1,061.00


Availability*
6 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Prom2 (NM_138750) Mouse Untagged Clone
Symbol Prom2
Synonyms AI507243; Prom-rp
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC221960 representing NM_138750
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACGCGCTCACCCGGCCTCATGGTGCCCCTGCTGGGCCTGAGCCTGGGACTGGCCCTGAGCCTGCCCG
AAGCTGTGACAGACGACTGCGGGTCCCTCGGGCGCGTGGAGCACCTGGCATTCGCTCGGGTGCCCAGGAC
ACGAGAGCTGGCCCCTCTTGTTCGCGCGTCGGGGCCCCTGAACTCCCTCTATGGCACCGTGCGACGATTC
CTCTCCGTGGTTCAACTTAACCCCTTCCCGGCAGAGTTGATAAAGACCCTGCTGAATGACCCATCTTCTG
TGAAGACAGATGAGGTGGTTCGATATGAGGCAGGCTACGTGGTGTGTGCTGTGATTGCTGGCCTCTACCT
CCTATTGGTGCCCATCACTGGGCTCTGCTTCTGTTGCTGTCGCTGCCGCCAGCGCTGTGGGGGCAGAGTG
AAGACGGAGCACAAGGCCATGGCCTGTGAACGTGGTACCCTCATGATCTTCCTGCTGCTGACCACCCTCG
TGCTTCTGATTGGTATGGTCTGTGCTTTTGCTACAAACCAACACACACATAGTCAGACGGGGCCCAGTGT
GAAAGCTGTCCCTGAGACCCTGCTCAGCCTAAGAGGCCTGGTCTCTGATGTCCCTGAAGAGCTGCGGGCC
ATTGCTGAGCAGTTCTCTGTGCCTCAGAAGCAAGTCTCAAAGGAGCTGGATGGTGTTGGTGAGAACCTTG
GGAACGTAATTCATAACCGGCTCAAGAGCACAGTGTACCCAGTGCTAGCCTCAGTGCACAGCCTGGGCCA
GGCCCTGCAGGTCTCCATAGACCACCTTCGAGCCCTGAACACCACCTCAGTGGAGCTGCAGGAGGCTCAG
CGGCACCTGGAGCCACCTGTGCAGGCGCACCGGGAACGCCTGCTCGCCCTGCTTCAGGACAGCTGGTGCC
ACGAGGAGAATTGCAAGCGGGTGCTCAGCCAGGCCGGTGCTCTGCAACTGGGCGCTGACTTTAGCCAGAC
GCCCCCTGTGGATGATGTCCTGCATCGGCTGAAGGATGTCCCAGAAACCAACTTCTCCAGCATGGTCCAG
GAGGAGAAAGCCACCTTCAATAACCTCCCGCTCCTGGTTCAAGTGCAGGCGGTCAGTGTGGTCAAAGATG
TGAAAAAGGCACTGGCTGAGCAGCCTGAAGGGTTGAGGATGCTGGCCCAAGCGTTCCCAGGTTCAGAGGC
AGCCTCCCGCTGGAGCCAGGCACTGGAGGGGCTGGAACAGCGCAGCCGCCCCTACTTGCAGGAGGTGCAA
CAATATGAGACATACAGGTGGATTTTGGGATGCGTGCTGTGCTCTGCCATCCTGCTTGTGGTGATCTGTA
ACCTGCTGGGCCTCAGCCTGGGCATCTGGGGGTTGTTTGCCAGGGAGGACCCCAGCCACTCTGAAACCAA
GGGCGAGGCTGGAGCCCGCCTCCTCATGGCAGGTGTGGCCTTCAGCTTCCTCTTCGCAGTCCCCCTCATC
CTCCTCGTCTTCGTCACTTTCCTGGTGGGTGGCAATGTGCAGACGCTGGTGTGCCGGAGCTGGGAGAGTG
GAGAGCTGTATGAGTTTGCAGACACTCCGGGGAACTTGCCACCATCCATGAACCTATCCTATCTTCTTGG
CCTGAAGAAAAACATCAGCATCGTCCAGGCCTATCGACAGTGTAAGGCAGGGGCAGTACTCTGGAAGGTT
CTACAGCTCAATGACTCGTATGACCTGGATAAGCACCTGGATATCAAACAGTATACCCACAAGATTCAGC
AGGAGCTTCAGAGCTTCCAAGTAGATTTGAAGGAGCTAGACCTGTTGAGCCCCACTGCCCGCCAGGACCT
GGAGGCTTTGCAGAGGAGCGGGCTGGAGAAAATCCACTACAGAGGCTTCCTTGTGCAGATCCAGAAGCCT
GTGGTGAACACTGACATGTGGCAGCTGGCGCAGGAGCTGGAAGGACTGGCCCAGGCCCAAAATGACTCTT
TACTGAGGCAGCAGCTACGGGAGGAGGCCAGAGAACTTCGAAGCCTCTACCAGGAGAAGGTTGTCCCCCA
GGAGAGCCTTGTGACCAAGCTCAACTTCAGTGTCAAGACCTTGGAGTCCTTGGCCCCAAGTCTGCAGGTG
AATACCTCAGACTTTCTTGACAGTGTCACTCGTCTAAAAGGAGAGCTGCCTGTGCAGATCAACCACATCC
TGAGGAATGCCACTGAGTGTTTCCTGACCAGGGAAATGGGCTACTTCTCTCAGTATGTGACCTGGGTGAG
AGCAGAGGTGACTCAGCGCATCGCCACCTGCCAGCCCTTCTCTACAGCCCTGGACAATGGTCATGTGATC
CTGTGTGACATGATGGCTGACCCCTGGAACGCCTTCTGGTTTTGCCTGGGGTGGTGCACCTTCTTCCTCA
TCCCCAGCATCATCTTCGCTGTCAAGACCTCCAAGTACTTCCGTCCCATCCGGAAACGCCTCAGCTCCAC
CAGCTCTGAAGAGACACAACTTTTCCATATCCCCAGGGTCACCTCTCTGAAGCTATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_138750
ORF Size 2508 bp
Insert Size 2508
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_138750.2, NP_620089
RefSeq Size 4266
RefSeq ORF 2508
Locus ID 192212
Cytogenetics 2|2 F1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.