Veph1 (NM_145820) Mouse Untagged Clone

CAT#: MC221949

Veph1 (untagged) - Mouse ventricular zone expressed PH domain homolog 1 (zebrafish) (Veph1), transcript variant Veph-A, (10ug)

USD 1,061.00


Availability*
5 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Veph1 (NM_145820) Mouse Untagged Clone
Symbol Veph1
Synonyms 2810471M23Rik; Veph
Vector pCMV6-Entry
Sequence Data
>MC221949 representing NM_145820
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCATCAACTTTTCAGATTGGTTTTGGGACAAAAAGATCTTTCAAAAGCTGGGGACCTCTTCTCTTTAG
ATGATGCTGAGATTGAAGACAGCCTGACAGAAGCTTTGGAGCAGATTAAAGTAATTAGCTCATCTTTGGA
TTACCAAACTAATAACAATGACCAGGCGGTGGTTGAAATCTGTATCACAAGGATTACCACAGCCATCAGA
GAGACAGAATCCATTGAAAAGCATGCCAGAGCCCTGGTGGGGCTGTGGGATTCCTGCTTGGAACACAACC
TGAGACCTGCAGGGAAAGACGAAGATACTCCACATGCAAAAATCGCCTCTGATATCATGAGTTGCATCTT
ACAGAATTACAACCGGACCCCTGTGATGGTCTTAGCTGTCCCCATCGCAGTGAAATTCCTCCACAGAGGC
AGCAAGGAGCTGTGTAGGAACATGTCCAACTACCTGTCCCTGGCTGCCATCACCAAGGCGGATCTGCTGG
CTGACCACACTGAAGGGATAATAAAGAGCATACTCCAAGGAAATGCCATGCTGTTAAGGGTGCTACCTGC
TGTATATGAAAAGCAGCCCCAACCAATCAACAGACACCTGGCAGAACTCCTGGCCTTGATGTCTCAATTG
GAGCAGACAGAACAGTACCATCTACTAAGGCTTCTGCACGTAGCAGCAAAGAGAAAAGATGTGGAGGTGG
TTCAGAAATGTGTTCCTTTCCTGATCAGAAATTTGAAGGATTCAACCTATAATGACATCATCCTAAACAT
TCTCATAGAAATAGCAGGCCATGAGCCACTGGCCTTGAACAGTTTCCTCCCGATGCTGAAAGAGATTGCA
GAGCAATTCCCCTACCTCACTGGACAGATGGCAAGGATCTTTGGTGCTGTTGGTCATGTGGATGAAGAGA
GAGCCAGGAGCTGCCTACGATACCTGGTGAGCCAGCTGGCTAATATGGAGCATCCATTCCACCATATTCT
CCTGCTGGAAATTAAGAGTATCACAGATGCCTTCTCCTCCATCCTGGGCCCGCACAGCAGGGACATCTTC
CGAATGAGCAACAGCTTCACCAACATTGCCAAGCTCCTTTCCAGACAACTGGAAAACAGCAAGGCTGACA
GTAGCAGGAGAAAAACCAGCACTGAAGTTAGCATTCCTGAGAAACTGAGAGAACTCAATTCCATGGAGCC
TGAAAGTGAAGACCATGAAAAACTCCAAGTTAAAATCCAAGCCTTTGAAGACAAAATAAATGCTGAGAGC
AATACCCCAGGCTCTGGCCGGAGATACAGCTTAGACCACATCTCTAAGGAAGAACGAAAAAGCATTAGAT
TTAGCAGGTCCAGAAGTTTGGCTTTGAATACTGTGCTCACAAACGGTGTGAGTGTGGAAGATAACGAAGT
CGAAGAAAAGGCAGGAATGCACGCCAGCATCTCTCTTTCGCAAATAGACCCACTCAGCCACGGGATTGGC
AAGTTGCCCTTTAAGACAGACACTCATGGATCACCACTGAGAAATTCCTCAGCTTCACACCCAAGTATTA
TACATACTGAACCAGAGACTATGCCCGAAACTTTTAAAGAAAACATCCAAGAAGAAATTCTAGAGGCAGC
CACAAGTCCTATTGAATACCAAGATAAGCTCTACTTGCATTTAAGGGAAAACCTCAGCAAAGTGAAGGCT
TATGCCTTGGAAATCGCAAAAAAGGTCCCAATCCCAGACCAGTGCACCATTGAAGATACTATGAGAAGTT
GCGTGGCAAAGCTGTTCTTTACCTGTTCTTTAAAGGGCCATTACTGCCTATACAGCAAGTCCAGCTTCAT
CCTTGTCAGCCAAGCACCCCAGCCGTGGATCCAGGTCATGTTTCTCTCCCAACAGAGCCTGTTTCCTGAG
CCCCTGTCCATTCAGAGTGGGTCTGTGCAGTTCCTCAAAGCCCTATGGGAGAAAACGCAGGACACGGGAG
CGCACAGCTTTGAAGTCGCCATGACAGAGTCCACCTTTCCACAGCAGAAGGATCTGGAGCAGCTTCAGCT
CCATCTGGAAGAAGTGCGGTTCTTCGACGTGTTTGGCTTCAGTGAAACAGCGGGGGCATGGCAGTGCTTC
ATGTGCAACAACCCTGAAAAGGCAACTGTTGTAAATCAAGATGGCCAGCCTCTCATCGAAGGAAAACTTA
AGGAGAAACAAGTGAGGTGGAAGTTCATCAAGAGGTGGAAAACGCATTATTTTACACTGGCCGGAAACCA
ACTTCTGTTTCAAAAGGGGAAATCTAAGGATGACCCTGATGATTCCCCGATAGAACTCAGCAAGGTACAG
AGCGTGAAAGCTGTGGCTAAGAAACGCCGGGACCGCTCTCTGCCTCGGGCGTTTGAAATCTTCACAGATA
GTAAGACCTATGTTTTCAAAGCCAAGGATGAGAAGAACGCAGAGGAATGGCTGCAGTGCATCAACGTGGC
GCTGGCCCAGGCAAAGGAGAGGGAAAGCCGAGAAGTAACCACATATCTGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_145820
ORF Size 2502 bp
Insert Size 2502
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_145820.3, NP_665819
RefSeq Size 6450
RefSeq ORF 2502
Locus ID 72789
Cytogenetics 3|3 E1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.