Ptpra (NM_008980) Mouse Untagged Clone

CAT#: MC221935

Ptpra (untagged) - Mouse protein tyrosine phosphatase, receptor type, A (Ptpra), transcript variant 1, (10ug)

USD 1,061.00


Availability*
6 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Ptpra (NM_008980) Mouse Untagged Clone
Symbol Ptpra
Synonyms Ptpa; Ptpalpha; Rptpalpha; Rptra; Rptralpha
Vector pCMV6-Entry
Sequence Data
>MC221935 representing NM_008980
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATTCCTGGTTCATTCTTGTCCTGTTTGGCAGTGGTCTAATACATGTTAGTGCCAACAATGCTACTA
CAGTTTCACCTTCTTTAGGAACGACAAGATTAATTAAAACATCAACAACAGAATTGGCTAAGGAAGAGAA
TAAAACCTCAAATTCAACCTCTTCAGTAATTTCTCTTTCTGTGGCACCAACATTCAGCCCAAACCTGACT
CTGGAGCCCACCTATGTGACTACTGTTAATTCTTCACACTCTGACAATGGGACCAGGAGGGCAGCCAGCA
CGGAATCTGGAGGCACTACCATTTCCCCGAACGGAAGCTGGCTTATTGAGAACCAGTTCACGGATGCCAT
AACAGAACCCTGGGAGGGGAACTCCAGCACTGCAGCAACCACTCCAGAAACCTTCCCCCCGGCAGATGAG
ACACCAATTATTGCGGTGATGGTGGCCCTGTCCTCTCTGCTAGTAATCGTGTTTATTATCATAGTTCTGT
ACATGTTAAGGTTTAAGAAATACAAGCAAGCTGGGAGTCATTCCAACTCTTTCCGCCTGTCAAATGGCCG
CACGGAGGATGTGGAGCCCCAAAGTGTACCACTTCTGGCCAGGTCCCCAAGCACCAACAGGAAGTACCCA
CCACTGCCTGTGGACAAGCTGGAAGAGGAGATTAACCGGAGAATGGCTGATGACAATAAGCTCTTCAGAG
AAGAATTCAACGCTCTCCCTGCTTGTCCTATCCAGGCCACCTGTGAGGCTGCCTCCAAGGAAGAAAACAA
GGAAAAAAACCGCTATGTAAACATCCTGCCCTTTCTCTCTTTAGCTGTGAGCAAGGATGCAGTGAAAGCA
CTGAACAAAACCACTCCATTGCTAGAAAGAAGGTTTATTGGGAAATCAAACTCCAGAGGCTGTCTCTCAG
ATGACCACTCTAGAGTGCACCTGACACCTGTTGAAGGGGTCCCAGATTCTGATTACATCAACGCTTCATT
CATTAATGGCTACCAGGAAAAGAACAAATTCATCGCTGCACAAGGACCAAAAGAAGAAACAGTGAATGAC
TTCTGGAGAATGATATGGGAACAAAACACAGCTACTATTGTCATGGTGACCAACCTGAAGGAGAGAAAGG
AGTGTAAATGTGCCCAATACTGGCCAGACCAAGGCTGCTGGACCTATGGGAATGTCCGTGTGTCTGTCGA
GGATGTGACTGTTCTGGTGGACTACACAGTACGGAAATTCTGCATCCAGCAGGTGGGCGACGTGACCAAC
AGGAAACCACAGCGCCTCATCACTCAGTTCCACTTCACCAGCTGGCCAGACTTTGGGGTGCCTTTCACCC
CAATTGGCATGCTCAAGTTCCTCAAGAAGGTGAAGGCCTGTAACCCTCAGTACGCAGGGGCTATCGTGGT
CCACTGCAGTGCAGGTGTAGGGCGCACTGGCACCTTTGTTGTCATCGATGCCATGCTGGACATGATGCAT
TCGGAACGCAAAGTGGATGTATACGGGTTTGTGAGCCGGATCCGGGCCCAGCGCTGCCAGATGGTACAGA
CAGACATGCAGTACGTCTTCATATACCAGGCCCTTCTGGAGCATTATCTGTATGGGGACACAGAACTGGA
AGTGACTTCTCTAGAAACCCACCTACAAAAAATTTATAACAAGATCCCAGGGACGAGCAACAACGGGTTA
GAGGAGGAGTTTAAGAAATTAACTTCAATCAAAATCCAGAATGACAAGATGCGCACGGGAAACCTTCCAG
CCAACATGAAGAAGAACCGGGTTTTACAGATCATTCCATATGAATTTAACAGAGTGATCATTCCAGTCAA
ACGAGGCGAAGAGAACACAGACTATGTGAACGCATCCTTCATTGATGGATACCGGCAGAAAGACTCCTAC
ATTGCCAGCCAGGGCCCTCTTCTCCACACGATTGAGGACTTCTGGCGAATGATCTGGGAGTGGAAGTCCT
GTTCTATCGTAATGCTGACAGAACTGGAAGAGAGAGGCCAGGAGAAGTGTGCCCAGTACTGGCCATCTGA
TGGCCTGGTGTCCTATGGAGACATCACAGTTGAGCTGAAGAAGGAGGAGGAATGTGAAAGCTACACTGTC
CGAGACCTCCTGGTCACCAACACCAGGGAGAACAAGAGTCGGCAAATCCGGCAGTTCCACTTCCACGGCT
GGCCTGAGGTGGGCATCCCCAGCGACGGCAAGGGCATGATCAACATCATTGCAGCAGTGCAGAAGCAGCA
GCAGCAGTCGGGGAACCATCCCATCACTGTGCACTGCAGTGCCGGGGCAGGACGGACAGGAACCTTCTGT
GCCTTGAGCACAGTCCTGGAACGTGTGAAAGCAGAAGGAATTTTAGATGTCTTCCAAACTGTCAAGAGCC
TGCGGCTGCAGAGGCCACACATGGTCCAGACACTGGAACAGTATGAATTCTGCTACAAGGTGGTACAGGA
GTACATTGACGCCTTTTCAGATTATGCCAACTTCAAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_008980
ORF Size 2490 bp
Insert Size 2490
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_008980.2, NP_033006
RefSeq Size 3609
RefSeq ORF 2490
Locus ID 19262
Cytogenetics 2 F1|2 63.23 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.