Arhgap44 (NM_001099288) Mouse Untagged Clone

CAT#: MC221775

Arhgap44 (untagged) - Mouse Rho GTPase activating protein 44 (Arhgap44), transcript variant 1, (10ug)

  View "NM_001099288" in other vectors (6)

USD 1,060.00


Availability*
5 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Arhgap44 (NM_001099288) Mouse Untagged Clone
Symbol Arhgap44
Synonyms 6330543G20; AI840762; AU040829; AW493732; Rich2
Vector pCMV6-Entry
Sequence Data
>MC221775 representing NM_001099288
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGAAGCAGTTTAACCGCATGCGCCAGTTGGCCAACCAGACGGTGGGCAGGGCAGAAAAGACTGAAG
TTCTGAGCGAAGACCTTCTCCAGGTGGAGAAGCGCCTAGAGCTGGTGAAGCAGGTGTCCCACAGCACACA
CAAGAAGCTCACCGCATGTCTGCAGGGTCAGCAGGGAGCAGAGGCCGACAAGCGATCAAAAAAGTTGCCT
CTGACGACTCTGGCGCAGTGCTTGGTGGAGGGGTCCGCGATCCTGGGCGATGACACGCTTCTTGGGAAGA
TGCTGAAGCTCTGCGGAGAGACGGAGGACAAGCTAGCTCAGGAGCTGATCCACTTTGAGCTGCAAGTGGA
GAGGGATGTGATCGAGCCCCTGTTCCTGCTCGCTGAGGTGGAAATTCCAAATATTCAAAAGCAGAGGAAA
CATTTAGCCAAGCTGGTGCTTGACATGGACTCTTCCCGGACCAGGTGGCAGCAGACTTCCAAGTCTTCAG
GGCTTTCCAGCAGCCTTCAGCCTGCGGGTGCCAAAGCCGATGCCCTCAGGGAGGAGATGGAGGAGGCTGC
CAACAGAGTGGAGATTTGCCGGGACCAGCTTTCTGCTGACATGTACAGTTTTGTGGCCAAAGAAATTGAC
TATGCAAACTACTTTCAAACGCTAATAGAAGTGCAAGCTGAGTACCACAGGAAGTCGCTGACACTGCTGC
AGGCTGTGTTGCCTCAGATCAAAGCCCAGCAGGAGGCCTGGGTGGAGAAGCCTTCCTTTGGGAAGCCCCT
GGAGGAGCACCTGATGATCAGTGGCCGAGAGATCGCCTTCCCTATCGAGGCGTGTGTGACCATGCTGCTG
GAGTGTGGGATGCAGGAGGAGGGCCTCTTCCGGGTAGCCCCCTCAGCCTCCAAGCTGAAGAAGCTGAAAG
CTGCTCTGGACTGCTGTGTGGTGGATGTCCAGGAGTACTCGGCTGACCCCCACGCCATAGCAGGGGCTTT
GAAGTCTTATCTCCGAGAGTTGCCAGAGCCTCTTATGACCTTTGAACTCTATGACGAATGGATCCAGGCT
TCTAATATCCAGGAGCAAGACAAGAGACTTCAGGCTCTCTGGAATGCTTGTGAGAAGTTGCCCAAGGCCA
ACCATAACAACATCAAATACTTGATCAAATTTTTATCGAAACTGTCTGAATATCAGGATGTAAACAAGAT
GACTCCCAGTAACATGGCAATTGTCCTGGGACCCAATCTCCTTTGGCCACAGTCAGAGGGGAACATCACC
GAGATGATGACCACAGTTTCCCTGCAGATCGTTGGCATCATCGAGCCCATTATCCAGCACGCAGACTGGT
TCTTCCCTGGAGAGATAGAGTTCAACCTCACAGGCAGTTACGGGAGTCCAGTCCACGTGAACCACAATGC
CAACTACAGCTCAATGCCCTCCCCAGACATGGACCCTGCTGACCGGCGCCAGCCAGAGCAGGCCCGCCGG
CCCCTCAGTGTTGCCACAGACAACATGATGCTGGAGTTTTACAAGAAGGATGGCATGGGTGTGAGGGTCA
TGGACACATCTTGGGTGGCACGAAGAGGCTCCTCTGCTGGTCGGAAAGCATCCTGCGCCCCGCCTTCCAT
GCAGCCTCCTGCCCCACCCTCCGAGCTGGCTGCACCCTTGCCTTCACCCCTGCCGGAGCAGGTCCCAGAC
AGCCCTGCCACTCCAGCTCCTGCGCTCTCTCCATCAGGTGCCAGCCTGCAGCCCACCCCCGAGCGCCCCA
GTGTGTCTAAAAGCAAGGAACTGTCGCCAGGGTCTGGGCAGAAAGGAAGTCCAGGTTCCATCCAGGGGAC
ACCCTGCCCAGGGACGCAACTGGGGCCACAGCCGGCTGCCAGCCCCAGCCAGCTTCCTGCAGACCAGAGT
CCTCACACCCTCCGGAAAGTTTCAAAGAAGGTGGCACCAATTCCTCCCAAGGTCCCCTTCGTGCAGCCAG
GGACTGTTTCAGATCAGCCCGTTGGCCAGCCATCCCCAGTCAGCCTGTCTCCTACTCCACCAAGCACCCC
ATCCCCCTATGGACTGAGCTACCCTCCAGGCTACTCCATGGCCTCTGGCCAGCTTTCTCCTGCCTCAGCT
CCTCCCCTGGCCTCTCCCTCTGTCTTTACAAGCACTTTAGCCAAATCTCGGCCCACCCCTAAGCCTCGAC
AGAGGCCCACCCTGCCGCCTCCTCAGCCTCCCAGTGTCAGCCTGTCGGCTTCAAGTCCACAGTCCACAGA
GCACCCCATGTTAGACGGCATGTCGCCGGGGGAAAGCATGTCTACAGATCTCGTCCACTTTGATGTCCCC
TCCATCCACATAGAGCTGGGGTCAACGCTCCGCCTGAGCCCCCTGGAACATGCACGGCGGCACTCGGCAA
CAGACAAGAGGGACTCGGAAGAGGAGTCTGAGAGTACAGCCCTTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001099288
ORF Size 2427 bp
Insert Size 2427
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001099288.1, NP_001092758
RefSeq Size 4047
RefSeq ORF 2427
Locus ID 216831
Cytogenetics 11|11 B3

Other Versions

Other products for "Arhgap44"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
10 percent off protein banner ad
68 Mouse Clones
20%off selected tag antibodies