Ap1g2 (NM_007455) Mouse Untagged Clone

CAT#: MC221618

Ap1g2 (untagged) - Mouse adaptor protein complex AP-1, gamma 2 subunit (Ap1g2), (10ug)

USD 1,010.00


Availability*
6 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Ap1g2 (NM_007455) Mouse Untagged Clone
Symbol Ap1g2
Synonyms Adtg2; G2ad
Vector pCMV6-Entry
Sequence Data
>MC221618 representing NM_007455
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTGGTGCATTCGTTGAGACTTCAGGACCTAATCGAAGAGATTCGCGGGGCCAAGACGCAGGCCCAGG
AACGGGAGGTGATCCAGAAGGAGTGCGCCCAAATTCGGGCCTCCTTCCGCGATGGGGATCCCCTGCAGAG
GCATCGCCAGCTGGCCAAACTGCTCTACGTCCACATGTTGGGCTACCCCGCCCACTTTGGACAGATGGAG
TGCCTGAAACTGATCGCCTCCCCCAGATTCACAGACAAGAGGGTGGGCTACCTTGGGGCCATGCTTCTAT
TGGATGAGAGGCACGATTCCCATCTGCTCATCACCAACAGCATCAAGAATGACCTGAGCCAAGGGAACCA
GCCAGTTCAAGGCCTGGCCCTGTGTACTCTGAGTACCATGGGCTCTGCTGAGATGTGCCGGGACCTAGCC
CCTGAGGTGGAAAAGCTGCTTCTGCAGCCCAGTCCCTATGTGCGGAAGAAGGCTATTTTGACTGCAGTGC
ACATGATCCGGAAGGACCCTGAGCTCTCCGGCATCTTCCTCCCACCTTGTACCAAACTGCTTCGTGAGCG
TCATCATGGCATCCAGCTGGGCACAGTCACGCTGATCACGGAGCTCTGTGAAAGAAACCCTGCAGCCCTC
AGGCACTTTCGCAAGGTAGTGCCGCAGCTGGTACAGATCCTCCGGACTCTGGTGACTACAGGATACTCCA
CGGAGCACAGCATCTCTGGAGTCAGCGACCCCTTCTTGCAGGTCCAGATACTCCGCCTACTTCGGATCCT
GGGACGGAACCATGAAGAAAGTAGCGAGACCATGAACGACTTGCTGGCCCAGGTCGCCACCAACACAGAC
ACCAGCCGAAATGCAGGCAACGCTGTCCTGTTGGAAACAGTGCTTACCATCATGGCCATCCACTCTGCTG
CTGGCCTCCGGGTTCTAGCTGTTAACATTCTTGGTCGTTTCTTGCTCAACAATGACAAGAATATTAGGTA
TGTGGCTCTGACATCATTGCTGCAGCTGGTGCAGTCTGACCACAGTGCTGTACAACGTCACCGGTCCACT
GTGGTGGAGTGTCTACAGGAAACGGACGCCTCCCTTAGCAGGCGGGCCCTGGAGCTGAGCCTGGCTCTGG
TGAACAGCTCCAATGTACGAGCCATGATGCAGGAGCTGCAGGCCTTTCTGGAGTCCTGCCCCCCTGATCT
TCGGGCTGATTGTGCCTCAGGCATTCTGTTGGCTGCGGAGAGGTTTGCTCCCAGCAAGCGATGGCACATA
GACACCATCCTGCACGTGCTGACCACGGCAGGAGCCCATGTGAGGGATGACGCAGTGGCCAACCTGACCC
AGCTGATTGGAGAGGCCGAGGAGCTGCATACCTACTCTGTGCGCCGTCTCTACAGTGCCTTAGCAGAGGA
TATCTCCCAGCAACCACTGGTTCAGGTGGCAGCCTGGTGCATTGGCGAGTATGGGGACCTCCTGCTGGAA
GGTAACTGTGAGGAGACGGAGCCTTTTCAGGTGGAAGAAGAGGACGTGCTAGCACTGCTGGAAAAGGTGC
TGCAGTCCCATATGTCCCTGCCAGCCACTCGGGGCTACGCCATCACAGCCCTCATGAAGCTGAGCACCCG
ACTCCGGGGAGACAACAATCGTATTCGCCAGGTGGTGTCCATCTACGGGAGCTGTGTGGACTTAGAGCTG
CAACAGCGGGCTGTGGAGTATAACACACTCTTCCAGAAGTACGACCACATGAGAGCCGCCATCCTAGAAA
AGATGCCTCTTGTAGAGCGTGGTGACCCCCACGTTAAAGAGGGAGGGAAGGAGAAGCAAACGGAAGCCCA
GCCCTTGGAAGTGACAGCCCCTGCCCCCACAGAACCCCAGGCCACCAAACTCTTAGATCTACTGGATCTC
CTGGGTGACACTTCAGAGCCTCTCTCTTCTGGGCATGCCCAGCATCTTCCTCCTCAGACTCCTTCCCCAG
GGGAAGCCTTAATTCATCTCCTTGACCTTCCCTGTACACCGCCACCCCCAGCTCCCATCCCCAGTGTCAG
AGTGTTTGAGCGTGAGGGCCTACAGCTGGATCTTTCTTTCATGCGGCCCTTGGAGACCCCTGCTTTGCTC
TTAGTCACTGCCACCACCACCAACTCCTCAAAGGAGGATGTTACCCACTTCGTTTGCCAGGCAGCTGTGC
CCAAGAGTTTCCAGCTGCAGTTACAGGCCCCCAGTGGGAACACAATTCCAGCTCAGGGTGGTCTTCCCAT
CACCCAGGTCTTCAGAATCCTCAATCCTAACCAGGCACCTTTGCGACTTAAGCTGCGCCTCACCTACAAC
CACTCTGGCCAGCCAGTACAGGAGATCTTTGAGGTGGATAACTTGCCTGTGGAGACGTGGCAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_007455
ORF Size 2376 bp
Insert Size 2376
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_007455.5, NP_031481
RefSeq Size 2688
RefSeq ORF 2376
Locus ID 11766
Cytogenetics 14|14 C3
Gene Summary This gene encodes the gamma-2 subunit of the adaptor protein complex 1 (AP-1). AP-1 complex is a heterotetramer comprised of two heavy and one each of medium and small subunits. The encoded protein is a heavy subunit of AP-1 complex that regulates polarized sorting of cargo at the trans-Golgi network and endosomes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015].
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.