Sp1 (NM_013672) Mouse Untagged Clone

CAT#: MC221564

Sp1 (untagged) - Mouse trans-acting transcription factor 1 (Sp1), (10ug)

USD 1,000.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Sp1 (NM_013672) Mouse Untagged Clone
Symbol Sp1
Synonyms 1110003E12Rik; AA450830; AI845540; Sp1-1
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC221564 representing NM_013672
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGCGACCAAGATCACTCCATGGATGAAGTGACAGCTGTGGTGAAGATTGAAAAAGATGTTGGTGGCA
ATAATGGGGGTAGCGGCAATGGTGGCGGTGCCGCCTTTTCTCAGACTCGAAGCAGCAGCACAGGCAGTAG
CAGCAGCAGTGGTGGCGGAGGAGGGCAGGAATCCCAGCCATCTCCTTTGGCTCTGCTGGCAGCAACCTGC
AGCAGAATTGAGTCACCCAATGAGAACAGCAACAACTCCCAGGGTCCGAGTCAGTCAGGGGGCACAGGTG
AACTTGACCTCACAGCCGCACAACTTTCACAGGGTGCCAATGGCTGGCAGATCATCTCTTCCTCCTCTGG
GGCTACCCCTACCTCAAAGGAACAGAGTGGCAACAGTACCAATGGCAGCGAGTCTTCCAAGAACCGCACA
GTCTCTGGTGGGCAGTATGTTGTGGCTGCTACCCCCAACTTACAGAACCAGCAAGTTCTGACAGGTCTCC
CTGGAGTAATGCCTAATATTCAGTATCAAGTAATCCCACAGTTCCAGACTGTTGATGGGCAGCAGCTGCA
GTTTGCTGCCACTGGGGCCCAAGTGCAGCAGGATGGTTCTGGTCAAATACAGATCATACCAGGTGCAAAC
CAACAGATCATCCCAAATAGAGGAAGTGGGGGCAACATTATTGCTGCTATGCCAAATCTACTCCAGCAGG
CTGTCCCCCTTCAAGGCCTTGCTAATAATGTGCTCTCAGGACAGACTCAGTATGTGACCAATGTACCAGT
GGCCCTGAATGGGAACATCACCTTGCTACCTGTCAACAGCGTTTCTGCAGCTACCCTGACTCCCAGCTCT
CAGGCAGGCACTATCAGCAGCTCTGGATCCCAGGAGAGCAGCTCACAGCCTGTCACCTCAGGGACTGCCA
TCAGTTCTGCCAGCTTGGTGTCATCACAAGCTAGTTCCAGCTCCTTTTTTACCAATGCCAATAGTTATTC
AACAACTACTACCACCAGCAACATGGGAATTATGAACTTTACCAGCAGTGGCTCATCAGGGACTAGTTCT
CAAGGCCAGACGCCCCAGAGGGTTGGTGGGCTACAAGGGTCTGATTCTCTGAACATCCAGCAGAACCAGA
CATCAGGAGGCTCGCTGCAAGGAAGTCAGCAGAAAGAGGGAGAGCAAAGTCAGCAGACACAGCAACAACA
AATCCTTATTCAGCCTCAGCTAGTTCAAGGAGGACAAGCTCTTCAGGCCCTTCAAGCAGCACCATTGTCC
GGACAGACCTTCACAACTCAAGCTATTTCCCAGGAAACCCTTCAGAACCTCCAGCTTCAGGCTGTTCAAA
ACTCTGGTCCCATCATCATTCGGACACCAACCGTGGGGCCCAATGGACAGGTCAGTTGGCAGACCCTTCA
GCTGCAGAATCTTCAAGTTCAGAACCCACAAGCCCAGACAATCACCTTGGCCCCTATGCAGGGTGTTTCC
TTGGGGCAGACTAGCAGCAGTAATACCACCCTAACACCCATTGCCTCAGCTGCCTCCATTCCTGCTGGCA
CAGTCACTGTGAATGCTGCTCAACTCTCCTCCATGCCAGGCCTCCAGACCATTAACCTCAGTGCATTGGG
TACTTCAGGGATCCAGGTGCACCAGCTTCCAGGCCTGCCTTTGGCTATAGCAAACACCCCAGGTGATCAT
GGAACTCAACTTGGTCTTCATGGATCTGGTGGTGATGGGATACATGATGAGACAGCAGGTGGAGAAGGAG
AGAATAGCTCTGATCTCCAACCCCAAGCTGGACGCAGGACTCGTCGGGAAGCATGTACATGCCCCTATTG
CAAAGACAGTGAGGGAAGAGCCTCAGGAGATCCTGGCAAAAAGAAACAGCACATTTGTCACATCCAAGGA
TGCGGCAAAGTATATGGCAAGACCTCACATCTCCGAGCACACTTGCGCTGGCATACAGGGGAGAGGCCAT
TCATGTGTAATTGGTCATATTGTGGGAAGCGCTTTACACGTTCGGACGAGCTTCAGAGACATAAACGTAC
ACATACAGGAGAGAAGAAATTTGCCTGCCCTGAGTGCCCTAAGCGTTTCATGAGGAGTGATCACCTGTCA
AAGCATATCAAGACTCACCAGAACAAGAAGGGAGGCCCAGGTGTAGCCCTGAGTGTGGGCACATTGCCCC
TGGACAGTGGGGCAGGTTCAGAAGGCACTGCCACTCCTTCAGCCCTTATTACCACCAATATGGTAGCCAT
GGAGGCCATCTGTCCAGAGGGTATTGCCCGTCTTGCCAACAGTGGCATCAACGTCATGCAGGTGACAGAG
CTGCAGTCCATTAATATCAGTGGCAATGGTTTCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_013672
ORF Size 2346 bp
Insert Size 2346
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_013672.2, NP_038700
RefSeq Size 7818
RefSeq ORF 2346
Locus ID 20683
Cytogenetics 15|15 F3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.