Ttll11 (NM_029774) Mouse Untagged Clone

CAT#: MC221108

Ttll11 (untagged) - Mouse tubulin tyrosine ligase-like family, member 11 (Ttll11), transcript variant 1, (10ug)

USD 927.00


Availability*
5 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Ttll11 (NM_029774) Mouse Untagged Clone
Symbol Ttll11
Synonyms 4932702F08Rik; 4933424A20Rik; AU043211; D2Ertd624e
Vector pCMV6-Entry
Sequence Data
>MC221108 representing NM_029774
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCGGCGCAGCAGCCCGGAGAAGAAGCCGGAGGCTGAGTGGGAGGCGGACGCGGCGGCGGCGGCGGCGG
CGACAGCAGCGGCGACCGAGTCGCTACCGGCGGAGACTGAGAAGCAGCAGGGCGTGGACGCTGGCGCGGC
CGGGGATCCAGAGCGCCTGGAGCTGGAGGAGCAGCCCAAGGACGTGGGCCGGATCCCGACCCCGACGCGA
CGCCACGCGCCCGAGGAAGGAGAGGCCCGCGTCGTCCGGCGGCTGCCACCAGCGCTGCCCCTGGCCCAGC
CGAGGCCGGCGGCGCGGGCCCTGAGCCAGCTCGTGAAGGCACGGGGCCGGAGCCGGAGCCGGGTCTACCG
GCGGAGCGCAGGCTCGATGCGGCCGGTCACCGTGGACAGCTCCAAGGCCCGCACCTCCCTGGACGCGCTC
AAGATCAGTCTTCGCCAGCTCAGGTGGAAGGAGTTCCCATTTGGCCGGCGCTTGCCTTGTGATATCTACT
GGCATGGAGTTTCATTTCGTGACAGTGACATACTCTCCGGTCAAGTGAACAAATTTCCAGGCATGACGGA
GATGGTGCGTAAGGTCACCTTGAGCCGAGCACTGAGGATCATGCAGAACCTGTTTCCAGAGGAGTACAAC
TTCTACCCTCGCTCCTGGATCCTGCCAGAAGAGTTCCAGCTCTTTGTGTCTCAGGTCCAAACGGTGAAAG
AAGGTGACCCCTCCTGGAAGCCCACTTTTATTGTGAAACCGGATAGTGGTTGTCAGGGTGATGGAATCTA
CCTCATTAAGGATCCCTGTGATGGTCGCCTGACTGGGACCCTCCATAACAGGCCGGCAGTGGTCCAGGAG
TACATCCGCAAGCCCCTCCTCATCGACAAACTCAAGTTCGACATCCGTCTGTATGTCTTGCTGAAGTCCT
TGGATCCCTTAGAGATTTATATTGCCAAAGATGGACTCTCTAGGTTTTGTACAGAGCCATATCAAGAACC
TAACCCCCAGAATCTGCACCATGTCTTTATGCACCTGACCAACTACTCCCTGAATATCCACAGCGGCAAG
TTTGTCCACTCTGACAGCGCCAGCACGGGCAGCAAGAGGACTTTCTCTAGCATTCTTTGTAGACTGTCTT
CCAAAGGTGTGGACATCAAGAAGGTCTGGTCTGATATCATCTCCTTAGTTATTAAGACTGTCATCGCCCT
GACCCCAGAGCTCAAAGTTTTCTACCAGTCAGACATCCCAACAGGGAGGCCGGGGCCCACCTGCTTCCAG
ATTCTAGGCTTTGACATTCTTCTGATGAAAAACTTGAAGCCTATGCTACTTGAAGTGAATGCAAACCCCA
GCATGCGAATTGAGCATGAATACGAACTCTCTCCAGGAGTGTTTGAAAATATCCCCAGCCTGGTGGATGA
AGAGGTAAAGGTGGCTGTGATCAGAGACACGCTGCGCCTCATGGACCCGCTGAAGAAGAAAAAGGAGATC
CACTTTCCAGATATCTATATGGACAGAAAACACAGAATTCCTCCAGTTTCTGACAGAATGTCTTCATGGA
AGCATAAGGGTTCCTCGCTTTCCATAGTCAGGTCTCAGCAGATGGAAAAGTCTTTCACTTCAAAGGAAGA
TCTGAACTGTGACCCGACTGGTGGTGACTCCGAGCCCAACCCTGAAGCCCATCTGCCCTCCATTTGCCTC
AAGCAGGTGTTCCCCAAGTATGCCAAGCAGTTCAACTACTTGCGCCTCGTGGACAGGATGGCCAATTTGT
TCATCCGATTTCTGGGAATCAAGGGGACGATGAAGTTGGGACCAACTGGCTTTCGGACCTTCATAAGGAA
CTGCAAACTCAGCAGCAGCAGCCTGTCCATGGCAGCTGTGGACATCCTCTACATAGACATCACAAGGAGG
TGGAACTCGGTGACCGTGGACCAGCGGGACTCAGGGATGTGTCTGCAGGCATTTGTCGAAGCTTTCTTCT
TCCTGGCCCAGAGGAAGTTCAAGCTGCAACCTCTCCATGAGCAGGTGGCGTCCTTGATTGACCTGTGTGA
ATACCACCTGTCCGTGCTGGATGAAAAACGCTTGCTGTGCCATCGGGGCCGGCCCCTCCAAAGAAATCCG
CCCCAGATGAACCGCCCAGAGCATTCAGCCACAGGCAGCTCTGCACCCCGAGTAATCGGGGCTAGCAAGC
TCTCTCAATCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_029774
ORF Size 2184 bp
Insert Size 2184
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_029774.2, NP_084050
RefSeq Size 3191
RefSeq ORF 2184
Locus ID 74410
Cytogenetics 2 B|2 23.9 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.