Cpeb3 (NM_198300) Mouse Untagged Clone

CAT#: MC221035

Cpeb3 (untagged) - Mouse cytoplasmic polyadenylation element binding protein 3 (Cpeb3), (10ug)


  "NM_198300" in other vectors (4)

Reconstitution Protocol

USD 1,050.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Cpeb3"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cpeb3
Synonyms 4831444O18Rik; CPE-BP3; mKIAA0940
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC221035 representing NM_198300
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGGATGATTTACTGATGGACAAAAGCAAAACCCAGCCCCAGTCTCAGCAGCAGCAGCGGCAGCAGC
AGCAGCAGCAGCAACAGCTCCAGCCCGAGCCCGGCGCAGCTGAAGCCCCGTCCACGCCCCTCTCCTCAGA
GATCCCCAAGCCCGAAGACAGTAGCGCAGTGCCGGCCCTCAGCCCCGCCTCGGCTCCGCCAGCCCCCAAC
GGCCCCGACAAGATGCAGATGGAGTCGCCGCTCCTGCCGGGCTTGAGTTTCCATCAGCCCCCTCAGCAGC
CGCCGCCGCCGCAGGAGCCCACGGCGCCCGGAGCGTCGCTGTCGCCGTCCTTCGGCAGCACCTGGTCCAC
AGGCACTACAAACGCGGTGGAGGACAGCTTCTTCCAGGGGATCACCCCAGTCAACGGGACCATGCTCTTC
CAAAACTTCCCGCACCACGTCAACCCGGTCTTCGGAGGCACCTTCTCGCCGCAGATCGGCCTGGCGCAGA
CCCAGCACCATCAGCAGCCTCCACCGCCCGCGCCGCAGCCGCCGCAGCCCGCGCAGCCCCCGCAGGCGCA
GCCCTCGCAGCAACGCCGCTCGCCCGCCAGCCCCAGCCAGGCGCCCTATGCGCAGAGGAGCGCCGCTGCC
TACGGCCACCAGCCCATCATGACCAGCAAGCCGTCCTCATCCTCGGCGGTCGCGGCTGCTGCGGCCGCGG
CCGCTGCCTCTTCGGCCTCGTCCAGCTGGAACACGCACCAGAGCGTGAACGCCGCCTGGAGTGCTCCGTC
CAACCCGTGGGGTGGCCTGCAGGCGGGCCGAGACCCTCGCCGCGCGGTCGGCGTGGGCGTGGGTGTAGGT
GTGGGGGTACCCTCCCCGCTTAACCCCATCTCGCCGCTCAAAAAGCCCTTCTCCAGCAATGTGATCGCTC
CACCCAAGTTCCCTCGTGCAGCCCCGCTCACCTCCAAGTCCTGGATGGAGGATAACGCTTTCCGGACCGA
TAATGGTAACAATCTGTTGCCTTTTCAGGACCGGAGTAGGCCCTATGACACTTTTAACTTGCACTCCTTG
GAGAACTCCTTAATGGATATGATAAGGACTGACCATGAGCCTCTGAAAGGTAAACACTACCCTCCCAGTG
GCCCACCAATGAGTTTCGCTGATATAATGTGGAGGAATCATTTTGCAGGACGCATGGGAATAAATTTCCA
CCATCCAGGAACAGATAACATTATGGCACTTAACACCAGGAGCTATGGGCGGAGACGAGGTCGGTCTTCT
CTCTTTCCCTTTGAAGACGCCTTCTTGGATGACAGCCATGGTGATCAGGCCTTATCGTCTGGCTTAAGTT
CTCCTACTCGATGTCAAAATGGGGAACGAGTGGAACGCTACTCTAGAAAGGTGTTTGTTGGAGGCCTTCC
TCCTGACATCGATGAAGATGAGATCACTGCCAGCTTTCGCAGGTTTGGACCCCTTGTGGTGGACTGGCCT
CATAAAGCCGAGAGCAAATCGTACTTCCCTCCTAAAGGCTATGCTTTCCTGCTGTTCCAGGAGGAGAGCT
CAGTGCAAGCTCTGATAGATGCCTGCCTGGAGGAGGATGGGAAACTGTACCTGTGTGTGTCCAGCCCAAC
CATCAAGGATAAACCGGTGCAAATCCGACCGTGGAACCTAAGTGACAGTGACTTTGTAATGGATGGCTCT
CAGCCTTTGGACCCCAGAAAAACTATCTTTGTTGGGGGAGTTCCACGACCCCTTCGAGCTGTTGAACTGG
CAATGATAATGGACCGTTTGTACGGTGGTGTTTGCTATGCTGGCATTGACACAGACCCAGAGCTGAAGTA
CCCGAAAGGTGCTGGGCGTGTTGCGTTCTCCAATCAGCAGAGCTACATTGCAGCCATCAGTGCGCGCTTT
GTGCAACTTCAACACAACGACATTGACAAACGGGTGGAAGTGAAGCCGTACGTGCTGGATGATCAGATGT
GTGACGAGTGTCAGGGCACACGCTGCGGGGGGAAGTTTGCCCCATTCTTCTGTGCCAACGTCACCTGTCT
GCAGTACTACTGTGAATACTGCTGGGCCAGCATCCACTCCCGAGCCGGCCGTGAGTTCCACAAACCGCTG
GTGAAGGAGGGAGGCGACCGCCCCCGGCACGTCCCGTTCCGCTGGAGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_198300
Insert Size 2151 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_198300.3, NP_938042.2
RefSeq Size 5970 bp
RefSeq ORF 2151 bp
Locus ID 208922
UniProt ID Q7TN99
Cytogenetics 19 C2
Gene Summary Sequence-specific RNA-binding protein which acts as a translational repressor in the basal unstimulated state but, following neuronal stimulation, acts as a translational activator (PubMed:17024188, PubMed:26074072). In contrast to CPEB1, does not bind to the cytoplasmic polyadenylation element (CPE), a uridine-rich sequence element within the mRNA 3' UTR, but binds to a U-rich loop within a stem-loop structure (PubMed:17024188). Required for the consolidation and maintenance of hippocampal-based long term memory (PubMed:26074003). In the basal state, binds to the mRNA 3' UTR of the glutamate receptors GRIA1 and GRIA2 and negatively regulates their translation (PubMed:17024188, PubMed:22153079). Also represses the translation of DLG4, GRIN1 GRIN2A and GRIN2B (PubMed:24155305). When activated, acts as a translational activator of GRIA1 and GRIA2 (PubMed:22153079, PubMed:26074003). In the basal state, suppresses SUMO2 translation but activates it following neuronal stimulation (PubMed:26074071). Binds to the 3' UTR of TRPV1 mRNA and represses TRPV1 translation which is required to maintain normal thermoception (PubMed:26915043). Binds actin mRNA, leading to actin translational repression in the basal state and to translational activation following neuronal stimulation (PubMed:26074072). Negatively regulates target mRNA levels by binding to TOB1 which recruits CNOT7/CAF1 to a ternary complex and this leads to target mRNA deadenylation and decay (By similarity). In addition to its role in translation, binds to and inhibits the transcriptional activation activity of STAT5B without affecting its dimerization or DNA-binding activity. This, in turn, represses transcription of the STAT5B target gene EGFR which has been shown to play a role in enhancing learning and memory performance (By similarity). In contrast to CPEB1, CPEB2 and CPEB4, not required for cell cycle progression (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1, 2, and 3 encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.