Zfp715 (BC040386) Mouse Untagged Clone

CAT#: MC220822

Zfp715 (untagged) - Mouse zinc finger protein 715 (cDNA clone MGC:27930 IMAGE:3585171), (10ug)

USD 907.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Zfp715 (BC040386) Mouse Untagged Clone
Symbol Zfp715
Synonyms mszf15
Vector pCMV6-Entry
Sequence Data
>BC040386
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGCAGATCCAAATTTCCAACAGAAGAGCCAGCCATTGGGTGCAGAGGAGCAGCCTGAGTCCTGTG
AGAGATGGATGTCCTTTGAGGATGTAACTGTGAACTTCAGCCAGGAGGAGTGGCAGCATCTGGACTCCGC
CCAGAGATGCCTGTACCAGGAGGTGATGCTGGAGATCTACAGCCACCTCTTGGCAGTGGGGTATTCCATT
CCCAGTCCTGGAGTCATCTTTAGGATGGAAAAAGGAAAGGAGGCACAGACAGCAAAGGCTGAATTCCCAG
GCCAGAGATGTCAAGAAAAATCAGGAAATGATACCTTACCACAGAAAGCATCTGGGAAAACATCAGTTTA
TAGCAATGTGGCAAGTGAAGTGACAAGAGATGGTTCATGGTGTTCCCTTTTACAAGAACTATGGCAGGGT
GCTGACATTACAAAGAGAGGTCAACAAAACCAGATTCTACTCTTCCCTCCTGGTTCTTTCCTCAAGAAAA
CTCTGAGCAAAAATAGTGATCATGAATATCAAAAGCCCAGGGAAACCATTCCTTTGGGACCCTACCTCAT
TTCAACACAAGAGGGTCTTCCACAATATCACTCACTTCCAAAAAGTTTGGATGTAAGCCTAGGAGCAAAT
GGTCATAATGAAAGAGATCAGCTCATTGACATTGTTGCATCCAGTCAACTCCTTATACCAGGCTCCTGTA
ATGCTAACTGTGTGGTTACTCATGGAGGAGAAGAATCATACAGAAGTACTGGGAATGGAGATGTTCTCAG
CCATAAACAACCACTGATCTATGGAAACCGTTTTCAGGTGAAAGCAGATCAAAGTTCTCAGTGCCAGGAG
GTACTCTATGCCATATCTTTGCATAAACCTGAGATCACTCTCACTGTGGACAGACCTATTGTTTCCTACA
ATGGTGGAAAGGCTTTCCTTTATGTGTCAGATTCACTGAGCCATCCATTCCAGCTGAAGGTGGACCGTGT
AGTTCATACTGGAGGAGACCCTTACAAGTGTAGCAGCTGTGAGAAATCCTTTTGTAATGCAGCTGCACTC
CAACAGCACGAGCAAATTCACACAGAAGAGAAACTGTATGTGTGTACTCTGTGTGGAAAAGCCTTCAGTG
ATGGGTCAGCTTTCTATGAACATGAATTGATTCACAAGAATCACACACCTTTTATCTGTGACATTTGTGG
GAAGGCCTTCTTACGTAAATCAGAGTTGACATCCCATAAACAATGTCACAATGGAGAGAAGCCTTACAAA
TGCAATGACTGTGAGAAGTCATTTAAATTTCCATCCCAACTGAAGGTGCATCATCAGATTCATACGGGTG
AGAAGCCTTATGAATGCCGTGAATGTGGGAAGTCATTCAGTAAAACAGCCAAACTCAAGGTGCATCAACG
GATTCACACAGGGGAGAAACCTTATGTGTGTTCTCAATGTGGAAAGGCCTTCAATCAGAAATCAATACTA
GACCGGCATGAGAAGCTTCACCCTGGGGAGAAGCCTTACAAATGCAATGACTGTGGGAAGTCATTTAATT
ACCCATCCCAACTGAAGGTGCATTGCCATAGTCACACAGGGGAGAAGCCTTACAAGTGCCATGAGTGTGG
GAAATCATTTAACTTTCCATGTGAACTAAAGGTGCATTATCAGAATCACACGGGAGAGAAGCCGTACAAA
TGCCGTGAATGTTGGAAACTGTTCAGTAAAATGTCCCAACTGAAGGCACATTATCGAGTTCACACAGGAG
AAAGACCTTATAAGTGCAGCCACTGTGGGAAAGCCTTCTCTACTAAGGAACAAGTCCAAGAGCATGAGCG
AATCCACACAGGAGAGAAACCCTTTGTGTGCACTGAATGTGGAAAAGCCTTCAGTAGCAGGTCATCTTTT
CGTAAGCATCAGTTAATTCACACTAAAGAGAAACCCTTTGTCTCTCAGAAATGTGAGACAGGCCTCCAGG
AGGCTACTTTGATACCCCATCAGCAACTTCATATTGGTGAGAAGCCTTACAAATGCCCTGATTGTGGGAA
GTTGTTTAATTATCCATCCCAATTGAAGTCACATTATCAAATCCACACAGGAGAGAAGCCTTGTAAATGT
CCTGACTGTGGGAAATCATTTAGTAAAACATCTCAACTGAAGGCACATTCTCGAATACACACAGGGGAAA
GGCCTTATGTGTGTTCTGTGTGTGGGAAGGCCTTCAAACAGTTGTCAACATTGAGTAGACATGAAAAAAT
TCACATGGTGGAAAAGCCTTACAAATGTAGTTTCTGTGGGAAGTCCTTTTGCTCTCCATCTGAACTGAAG
GTGCATCTTCTAATTCACACAGGGGAGAGACCTTATAAATGCAGCAGCTGTTGGAAAGCCTTTTGTACTA
AGGTCCAACTCCAAGAACATGAGCGAATTCACACAGGAGAGAGACCTTATGTGTGCACTCATTGTGGGAA
AGCCTTTAGAAGCAGGTCAGTTTTCTCTAAACATAAGTTGATTCACAGGAAGGAAACACCTTTTATCTGT
GAGAGATGTGGGAAAGTGTTCTTACAGAAGTCAGAGTTGACATCTCATCTACAAACTCATATTGAAGACA
AACCTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN BC040386
ORF Size 2598 bp
Insert Size 2598
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC040386,
RefSeq Size 4370
RefSeq ORF 2598
Locus ID 69930
Cytogenetics 7|7 B3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.