Tbx2 (NM_009324) Mouse Untagged Clone

CAT#: MC220763

Tbx2 (untagged) - Mouse T-box 2 (Tbx2), (10ug)

USD 907.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Tbx2 (NM_009324) Mouse Untagged Clone
Symbol Tbx2
Vector pCMV6-Entry
Sequence Data
>MC220763 representing NM_009324
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGAGAGCCGGCGCTGGCAGCCAGCGCCATGGCTTACCACCCGTTCCACGCGCCACGGCCCGCCGACT
TCCCCATGTCCGCCTTCCTGGCGGCAGCGCAGCCCTCCTTCTTCCCGGCGCTAGCGCTGCCGCCCGGCGC
GCTAGGCAAGCCTCTGCCGGACCCGGGCCTGGCGGGGGCGGCGGCCGCGGCAGCAGCGGCGGCGGCGGCG
GCCGAGGCGGGGCTGCACGTCTCGGCACTCGGCCCGCACCCGCCCGCCGCGCATCTGCGCTCGCTCAAGA
GCCTGGAACCCGAGGACGAGGTGGAGGACGACCCCAAGGTGACGCTGGAGGCCAAGGAGCTGTGGGACCA
GTTCCACAAGCTGGGCACCGAGATGGTCATCACCAAGTCCGGGAGGCGGATGTTCCCCCCCTTCAAGGTG
CGAGTCAGCGGCCTGGACAAGAAAGCCAAATACATCCTGCTAATGGACATCGTGGCTGCCGATGACTGCC
GCTATAAGTTTCACAACTCCCGCTGGATGGTGGCAGGCAAAGCCGACCCCGAGATGCCTAAACGCATGTA
CATCCACCCGGACAGTCCGGCCACAGGGGAACAGTGGATGGCCAAGCCTGTGGCCTTCCACAAACTGAAG
CTGACCAACAACATTTCTGACAAGCATGGCTTTACCATCCTGAACTCCATGCACAAGTACCAGCCGCGAT
TCCACATCGTGCGAGCCAATGACATCTTGAAGCTCCCATACAGCACCTTCCGCACCTATGTCTTCCCAGA
GACCGACTTCATCGCTGTCACTGCCTACCAGAATGACAAGATTACACAGCTGAAGATCGACAACAACCCC
TTTGCCAAGGGCTTCCGGGACACTGGGAACGGCCGTCGGGAGAAAAGGAAGCAGCTAACGCTGCCCACTC
TCCGTTTGTATGAGGAGCACTGTAAGCCGGAGCGTGATGGCGCTGAATCCGATGCCTCGTCCTGCGACCC
TCCGCCTGCGCGAGAACCACCGCCCTCCCCCAGCGCAGCGCCCAGCCCTCTGCGCCTACACCGGGCCCGA
GCCGAGGAGAAGCCGGGCGCAGCCGACAGCGATCCTGAGCCGGAGCGGACGGGGGAGGAGCGCTCCGCAG
CGCCCCTGGGCCGCAGCCCTTCGCGGGACGCCAGCCCCGCTCGCTTGACCGAACCCGAACGCTCCCGGGA
GCGGCGCAGCCCGGAGAGGTGCAGCAAGGAACCGACGGAGGGCGGTGGGGACGGCCCGTTTAGCCTGCGG
AGCCTGGAGAAGGAGCGTCCCGAGGCCCGGAGGAAGGACGAGGGGCGCAAGGACGTGGGTGAGGGCAAGG
AGCCCAGCCTGGCGCCGCTGGTGGTGCAGACAGACAGTGCGTCCCCCCTGGGTGCGGGCCATCTGCCTGG
CCTGGCCTTCTCCAGCCACCTGCATGGGCAGCAGTTCTTTGGGCCGCTGGGAGCTGGCCAGCCCCTCTTC
CTGCACCCAGGACAATTCGCCATGGGCCCCGGAGCCTTCTCCGCCATGGGCATGGGTCATCTGCTAGCCT
CGGTGGCAGGCGGCAGTGGCAGTAGCGGAGGCGCCGGTCCCGGAACCGCGGCGGGGCTGGACGCAGGCGG
GCTAGGTCCCGCAGCCAGCGCAGCAAGCACCGCGGCTCCCTTCCCGTTCCACCTCTCCCAGCATATGCTG
GCATCTCAGGGAATCCCAATGCCCACTTTCGGAGGCCTCTTTCCCTACCCGTACACTTACATGGCAGCAG
CGGCCGCCGCCGCCTCCGCTTTACCCGCCACCAGCGCTGCAGCTGCCGCCGCCGCAGCCGCTGGTTCATT
ATCACGGAGCCCATTTCTGGGCAGTGCCCGGCCCCGTCTGCGCTTCAGTCCTTACCAGATCCCTGTCACC
ATCCCACCTAGCACTAGCCTCCTTACCACCGGGCTGGCGGCGGAGGGCTCCAAGGGCGGAAATAGCCGTG
AGCCCAGTCCGCTGCCTGAGCTGGCTCTCCGAAAAGTGGGGGGCCCATCCCGCGGGGCCCTATCGCCCAG
CGGCTCAGCCAAAGAGGCGGCCAGTGAACTGCAGAGCATCCAGAGACTGGTGAGTGGGCTAGAGAGCCAG
CGAGCCCTCTCCCCCGGCCGGGAGTCGCCCAAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_009324
ORF Size 2136 bp
Insert Size 2136
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_009324.2, NP_033350
RefSeq Size 3562
RefSeq ORF 2136
Locus ID 21385
Cytogenetics 11 C|11 51.34 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.