Sec14l5 (NM_001127725) Mouse Untagged Clone

CAT#: MC220638

Sec14l5 (untagged) - Mouse SEC14-like 5 (S. cerevisiae) (Sec14l5), (10ug)

USD 897.00


Availability*
5 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Sec14l5 (NM_001127725) Mouse Untagged Clone
Symbol Sec14l5
Vector pCMV6-Entry
Sequence Data
>MC220638 representing NM_001127725
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTGCAAAAATATCAGTCTCCTGTCCGAGTATACAAGTATCCATTCGAGCTGGTCATGGCGGCCTACG
AGAAGCGCTTCCCCACCTGCCCGCTTATCCCAGTCTTTCTGGGGAGTGAAGTCCTGGGCGAGTGGCGGAG
CACAGATGGGGCAGTGCACACCGTGGAGCGGAGCTGCAGGCTGCGAGTGGATGCCCCGCGGCTGCTGCGG
AAGATTGCTGGTGTGGAGCACGTGGTCTTCATTCAGAGAAACGTCCTGAACTGGAGAGAGAGAACGCTGC
TGATAGATGCTCACAATGAGACGTTTGCGAGCCGAGTGACAGTGAAGGAGAGCTGCCGCTACACAGTCCA
TCCTGAGAATGAAGACTGGACTTGCTTTGAACAGTCTGCCTCCCTGGATGTCCGCTCTTTCTTTGGCTTT
GAAAGCACGTTGGAGAAGATCGCCATGAAGCAGTACACTGCCAATGTCAAGAGGGGGAAGGAGGTGATTG
AACACTATCTGAATGAGCTCATTTCCCAGGGAACATCCCACATTCCCCGCTGGACACCAGCCCCAGTCCA
GGAGGAGGACGTCCGCAGCCAGCTTGTGCCCCAGTGCCCTAGCTCCCTGGACATGGAGGGTCCCAGTGAT
GCCCCAGGCCCTGCTTCTGAGATGGCCATAGCGGATGGGGACAAGCTGGATGCAGACTACATTGAGAGAT
GTCTGGGCCATCTCAGTCCCATGCAGGAGAGTTGCCTGGTTCAGCTTCGGCACTGGTTACAGGAGACCCA
CAAAGGCAAGATCCCCAAAGACGAGCATATCCTGCGCTTCCTGAGGGCACGAGACTTCCACCTGGACAAG
GCCCGGGACATGTTGTGCCAGTCCTTGAGCTGGCGGAAGCAGCACCAGGTGGATCTCCTTCTGCAGACCT
GGCGGCCCCCTCCCCCCCTGCAGGAGTTCTATGCTGGAGGCTGGCACTACCAGGATATAGATGGCCGCCC
CCTTTACATCCTGCGCCTGGGACAGATGGACACCAAAGGCCTGATGAAGGCGGTAGGAGAGGAAGCTCTG
CTGCAGCACGTTCTTTCTGTCAATGAGGAAGGACAGAAGAGATGCGAAGGGAACACGAGACAATTTGGGC
GTCCCATCAGCTCCTGGACCTGCTTGCTGGACCTGGAGGGCCTCAACATGCGGCATTTGTGGCGACCTGG
AGTGAAAGCCCTACTGCGGATGATCGAGGTGGTAGAGGACAATTACCCCGAGACTCTGGGCAGGCTGCTC
ATCGTGCGTGCTCCCCGAGTCTTCCCAGTGCTATGGACACTGGTCAGCCCCTTCATCAATGAGAACACCA
GGCGGAAGTTCCTCATCTACAGTGGCAGTAATTACCAGGGCCCTGGCGGCCTAGTGGACTATCTGGACAA
GGATGTGATCCCTGACTTCCTCGGAGGGGAGAGCGTGTGTAATGTTCCAGAAGGAGGGATGGTCCCCAAG
TCCCTCTATCTGACAGAGGAGGAGCAGGAGCAGGCTGACCAGCTACAGCAGTGGAGTGAAACCTACCATT
CTGCCAGTGTGCTCCGAGGGACCCCCTATGAGGTTGCCATGGAGATACCAGAAGGGGAGTCAGTCATCAC
CTGGGACTTTGATATCCTCAGAGGGGATGTGGTGTTCAGTCTGTACCATGCAAAGCAGGCACCCAAGCTC
AGTCCCCAGGAGCCTGGAGTGAGAGCCAGTGGGCAGCTGATTGACAAGAGCTGGATCCTGGGGGTGGATT
ACAGCCGTGTAGAGGCACCCCTCATCTGCCGGGAAGGGCAGAGCATTCAGGGCTCCCATGTTACTCAGTG
GCCTGGCATCTACCTGCTCCAGTGGCAGATTCACAGTTCCCCTGAGAGTGTGGCCTGCAGTCTCCCAGGT
GTGGATGACGTCCTGACGGCTCTGCACAGCCCTGGCCCCAAGTGCAAGCTGCTGTACTACTGTGAAGTGC
TGGCATCTGAAGACTTTAGGGGCTCCATGTCCAGCCTGGAATCCTGTGCCAGCCGCTTCTCTCAGCTCAG
CGCCACCACCTCCTCTTCCTCCTCTGGCCAGTCCCACAGTGGCTCGATGGTGTCCAGATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001127725
ORF Size 2091 bp
Insert Size 2091
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001127725.1, NP_001121197
RefSeq Size 2337
RefSeq ORF 2091
Locus ID 665119
Cytogenetics 16|16 A1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.