Zfp760 (NM_001008501) Mouse Untagged Clone

CAT#: MC220288

Zfp760 (untagged) - Mouse zinc finger protein 760 (Zfp760), (10ug)

USD 845.00


Availability*
5 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Zfp760 (NM_001008501) Mouse Untagged Clone
Symbol Zfp760
Synonyms 9430018I06; BC029103
Vector pCMV6-Entry
Sequence Data
>MC220288 representing NM_001008501
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGCTTCTCCAGGTCTGTTGACATTCGGGGATGTGGCTTTGGACTTCTCCCAGGAGGAGTGGGAAT
GCCTGGACTCTGCTCAGAGGGCTCTGTACATTGATGTGATGTTGGAAAATTACATCAACTTGGTCTCTGT
TGAGAAGCATCACATGTGTGGTAAATATGAGAAGGTCTTGGATCAACACTCAGAGCATCAACATGTGAAT
ATCCAAGAAAAGTCTTACAAATATAAAGAGCTTGGCAAAATGGTTCATGAATCCTCTCCATGTACACCTT
ATAACACAAGTAGTACTGCAGAAAACTGTAACAAGTACAGCTACCAGGATGCTTCCATTGAATCATCCCT
AATCAGACATAATAGTGTACACACTGGAGAAGAACTTTTCAAATATAAAGAGTGTGGCAAATGTTTATGT
TCCAACATTTGTCCAAATCAGAGTATCCACGATATAAAGATGGAACACAAGTATACAGAAAGTGATAAGC
TTTGTGGCTCTACACACAGACTTGTACAGCAAAGAACTCATAGTGGAGAGAAAGCACACAATTGTGGGAA
ATGCTTTAGGAGTTGCTCAAGCCTCAGTACACATCAGAGACTTCACACTGGAGAGAAACCATGGAAATGT
AAAGAATGTGGTAAGTCCTTTAAGTGGTTGTCTCATCTTAAAGCCCATTGCAGAATCCATACTGGAGAAA
AACCTTTCAAATGTAATGAATGTGATAAAGGCTTTTCACGGTTATCTAGACTTAAAAGTCATTATAGAAC
CCATACTGGAGAGAAGCCTTACAAATGTGAGGAATGCGGTAAGTGCTTTTCTCGGTTGTCAAGACTTAAA
AACCATTATAGAATCCATACAGGAGAGAAACCTTACAAGTGTAAGGAATGTGGCAAATCTTTTACCCATT
GCACGGGTCTTAGTACACATCAGAAAATTCATACTGGGGAGAAACCTCACAAATGCAAAAACTGTGGTAA
ATCCTTTCATCTGCTGTCAACTCTTAAAGAACATTTCAGAGTCCACACTAGAGAGAAGCCTTACAAGTGC
AAAGAATGTGGTAAGTTCTTCCATTGGTTGTCAGGCCTTAAAAGCCACTACAGAATCCACACTGGAGAGA
CACCTTACAAATGTAAGGAGTGTGACAAGTCATTTTCTCAGTTATCAAGACTTAAAAGCCATTATAGAAC
CCATACTGGAGAGAAATCTTGCAAATGTTTAGAATGTGACAAATACTTTACCCAATGCACAGCTCTTAAA
AGACATCAGAAAATTCATACTGATGAAAAACCCTACAAATGTGAAGAGTGCAGCAAATGTTTTTATGTGT
TGTCTCACCTAAAAAGCCATTGCAGAACCCATACTGGAGAGAAGCCTTACAAATGTGAGGAATGTGGTAA
GTGCCTTTCTCAGTTGTCAAAACTTAAAAGCCATTATAGAATCCATACAGGAGAGAAACCTTATAAGTGT
AAGGAATGCGACAAATCCTTTACCCATTGCACAGCTCTTAGTACACATCAGAAAATTCATACTGGAGAGA
AACCCTACTCATGCAAAGACTGTGGTAAATCCTTTTATCTGTTATCAAGACTTAAAGAACATTACAGAGT
CCACACTGGAGAGAAACCGTACAATTGTAAGGAATGTGGTAAGTTCTTCCATTGGTTGTCAAACCTTAAA
AGACATTCCAGAATTCACACTGGAGAGAAACCTTACAAATGTGAGGAATGTGACAAATCCTTTACCCACT
GCTCAAGTCTTAAAGCTCATCAGAAAATTCATGCTGGGGTAAAACCCTACAAATGTGAAGAATGTAGCAA
GTCCTTTTATTGGTTGTCAAACCTTAAAACCCATTCCAGAATCCACACTGGAGAAAAACCTTACAAATGT
GGTAAATGTGACAAATCCTTTACCCAGCGCTCTCTTCTTACAAAGCACAACAGGATCCATACTAGAGAAA
AACATGAAAACAGGAAATATGTGAGAACTTTTGATGAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001008501
ORF Size 2001 bp
Insert Size 2001
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001008501.2, NP_001008501
RefSeq Size 4209
RefSeq ORF 2001
Locus ID 240034
Cytogenetics 17|17 A3.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.