Abcg1 (NM_009593) Mouse Untagged Clone

CAT#: MC220229

Abcg1 (untagged) - Mouse ATP-binding cassette, sub-family G (WHITE), member 1 (Abcg1), (10ug)

USD 845.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Abcg1 (NM_009593) Mouse Untagged Clone
Symbol Abcg1
Synonyms Abc8; AW413978; White
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC220229 representing NM_009593
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCTGTCTGATGGCCGCTTTCTCGGTCGGCACCGCCATGAATGCCAGCAGCTACTCTGCCGCAATGA
CGGAGCCCAAGTCCGTGTGCGTGTCAGTGGACGAGGTCGTGTCCAGCAACGTGGATGAGGTTGAGACAGA
CCTGCTCAATGGGCACCTGAAGAAGGTGGACAACAACTTCACAGAGGCCCAGCGCTTTTCCTCCCTTCCG
CGGAGGGCGGCCGTGAACATCGAATTCAAGGACCTTTCCTACTCTGTACCCGAGGGGCCCTGGTGGAAGA
AGAAAGGATACAAGACCCTTTTGAAAGGGATCTCTGGGAAATTCAACAGTGGAGAGCTGGTGGCCATCAT
GGGTCCTTCTGGAGCTGGGAAGTCCACACTCATGAATATTCTGGCAGGATACAGGGAGACTGGCATGAAA
GGGGCAGTCCTTATCAATGGAATGCCCCGGGACCTGCGCTGCTTCCGGAAGGTCTCCTGCTACATCATGC
AGGACGACATGCTGCTGCCTCACCTCACTGTTCAGGAGGCCATGATGGTGTCCGCGCATCTGAAGCTGCA
GGAGAAGGATGAAGGCAGACGAGAGATGGTCAAAGAGATCCTGACAGCCCTGGGCTTGCTGCCCTGTGCC
AACACACGCACGGGGAGCCTCTCAGGCGGCCAGCGGAAACGCCTGGCCATTGCCCTGGAGCTGGTCAACA
ACCCGCCTGTCATGTTCTTTGATGAGCCCACCAGTGGCCTGGACAGCGCCTCCTGCTTCCAAGTGGTGTC
TCTGATGAAAGGACTGGCCCAGGGTGGCCGCTCCATCGTCTGTACCATCCACCAGCCCAGTGCCAAGCTC
TTTGAGCTCTTTGACCAGCTTTATGTCCTAAGTCAAGGACAATGCGTATACAGGGGAAAGGTCTCCAATC
TCGTGCCGTATCTGAGGGATCTGGGTCTGAACTGCCCTACCTACCACAACCCAGCAGACTTTGTCATGGA
AGTGGCATCAGGGGAGTACGGGGATCAGAACAGTCGCCTGGTGAGAGCCGTGCGAGAGGGCATGTGTGAC
GCTGACTATAAGAGAGACCTCGGGGGCGACACCGATGTGAACCCGTTTCTTTGGCACCGGCCTGCTGAAG
AGGACTCCGCCTCCATGGAAGGTTGCCATAGCTTCTCGGCCAGCTGCCTCACCCAGTTCTGCATCCTCTT
CAAGAGGACCTTCCTCAGCATCATGCGGGACTCGGTCCTGACACATCTGCGAATCACCTCGCACATTGGG
ATCGGCCTGCTCATTGGCCTGCTGTACCTGGGGATTGGGAACGAAGCCAAGAAGGTCCTGAGCAACTCCG
GCTTCCTGTTCTTCTCCATGCTGTTCCTCATGTTTGCTGCCCTCATGCCCACCGTTCTGACCTTTCCCCT
GGAGATGAGTGTTTTCCTCCGGGAGCACCTGAACTACTGGTACAGCCTGAAGGCCTACTACCTGGCAAAG
ACCATGGCCGATGTCCCCTTTCAGATCATGTTCCCTGTGGCCTACTGCAGTATCGTATACTGGATGACGT
CCCAGCCGTCGGACGCTGTGCGTTTTGTGCTGTTCGCTGCTCTGGGTACCATGACATCGCTGGTGGCCCA
GTCCTTAGGCCTACTGATTGGAGCTGCATCCACATCCCTGCAGGTTGCGACATTTGTGGGTCCCGTGACA
GCCATCCCCGTCCTGCTCTTCTCCGGATTCTTTGTCAGCTTTGACACCATCCCAGCCTACCTGCAGTGGA
TGTCCTACATCTCCTATGTCAGATACGGCTTTGAGGGGGTCATCCTGTCCATCTACGGCTTGGACCGAGA
AGACCTGCACTGCGACATCGCGGAGACATGCCACTTCCAGAAGTCAGAGGCCATCCTGCGGGAGCTGGAC
GTGGAGAATGCGAAGCTGTACCTGGATTTCATCGTCCTGGGCATCTTCTTCATCTCCCTGCGGCTCATCG
CCTATTTCGTCCTCAGATACAAAATCCGGGCTGAGAGGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_009593
ORF Size 2001 bp
Insert Size 2001
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_009593.2, NP_033723
RefSeq Size 5821
Locus ID 11307
Cytogenetics 17|17 A3.3
Gene Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. The human protein is involved in macrophage cholesterol efflux and may regulate cellular lipid homeostasis in other cell types. [provided by RefSeq, Jul 2008].
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.