Mthfr (NM_010840) Mouse Untagged Clone

CAT#: MC220143

Reviews ()
Write a review

Mthfr (untagged) - Mouse 5,10-methylenetetrahydrofolate reductase (Mthfr), transcript variant 2, (10ug)



  "NM_010840" in other vectors (4)

Reconstitution Protocol

USD 1,012.00


Availability*
3 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Mthfr
Synonyms AI323986
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC220143 representing NM_010840
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTGAACGAGGCCAGAGGAAGTGGCAGTCCCAACCCGCGATCTGAGGGCAGCAGCAGTGGCAGCGAGA
GTTCCAAGGACAGTTCAAGATGTTCCACCCCCAGCCTGGACCCAGAGCGGCACGAGAGACTCCGGGAGAA
GATGAGGCGCAGAATGGACTCTGGTGACAAGTGGTTCTCCCTGGAGTTCTTCCCCCCTCGAACTGCTGAG
GGAGCTGTTAACCTCATCTCCAGGTTTGACCGGATGGCAGCAGGGGGCCCCCTCTTCGTAGATGTTACCT
GGCACCCAGCTGGAGACCCTGGCTCAGACAAGGAGACCTCCTCCATGATGATCGCCAGCACAGCAGTAAA
CTACTGCGGCTTGGAAACCATCCTGCATATGACCTGCTGCCAGCAGCGCCCGGAGGAGATCACAGGCCAT
CTGCACAGAGCCAAGCAGCTGGGCCTGAAGAACATAATGGCGCTGAGGGGAGACCCTGTAGGTGACCACT
GGGAAGCAGAGGAAGGAGGCTTCAGCTATGCCACAGACCTGGTGAAGCACATCCGGACCGAGTTTGCTGA
CTATTTTGACATCTGTGTGGCAGGTTACCCCAGAGGCCACCCCGATGCAGAGAGCTTCGAGGATGACCTG
AAGCATTTGAAGGAGAAGGTATCTGCAGGCGCCGACTTCATTATCACTCAGCTCTTCTTTGAGGCCAGCA
CCTTCTTCAGCTTTGTGAAGGCCTGCACAGAGATAGGCATCTCTTGCCCTATCCTGCCTGGGATCTTCCC
TATTCAGGGCTACACTTCCCTTCGGCAGCTTGTAAAACTGTCCAAGCTGGAGGTGCCACAGAAGATCAAG
GATGTAATTGAGCCCATCAAAGACAACGATGCTGCCATCCGCAACTACGGCATTGAGCTGGCTGTAAGCC
TGTGCCGGGAGCTGCTGGACAGTGGCTTGGTGCCAGGCCTCCACTTCTATACCCTCAACCGCGAGGTGGC
CACCATGGAGGTGCTAAAGCAACTGGGCATGTGGACCGAGGACCCCAGGCGTCCCTTGCCCTGGGCTCTC
AGTGCGCATCCCAAGCGCCGGGAGGAAGATGTCCGTCCCATCTTCTGGGCCTCCAGACCAAAGAGCTACA
TCTACCGCACACAGGACTGGGATGAGTTTCCTAACGGCCGCTGGGGTAATTCTTCCTCACCAGCCTTTGG
GGAGCTGAAAGACTACTACCTCTTCTACCTGAAAAGCAAGTCCCCCAGGGAGGAGCTGCTGAAGATGTGG
GGCGAGGAGCTCACCAGCGAAGAGAGTGTCTTTGAAGTCTTTGAACACTACCTCTCTGGAGAGCCGAATC
GCCATGGCTACAGAGTAACCTGCCTGCCCTGGAACGATGAACCCCTGGCAGCGGAAACCAGCCTGATGAA
GGAAGAGCTGCTCCGCGTGAACAGGCTGGGCATCCTCACCATCAACTCTCAGCCCAACATCAACGCAAAA
CCATCCTCAGACCCTGTTGTGGGCTGGGGCCCCAGTGGGGGTTATGTCTTCCAGAAGGCCTACCTCGAAT
TCTTCACCTCCCGTGAAACTGTGGAGGCGCTTCTGCAGGTGCTGAAGACATACGAGCTGCGGGTCAACTA
CCACATCGTGGACGTGAAGGGAGAGAACATCACTAATGCCCCTGAGCTGCAGCCCAATGCCGTGACGTGG
GGCATCTTCCCGGGTCGAGAGATCATCCAGCCTACTGTGGTGGACCCCATCAGCTTCATGTTCTGGAAGG
ATGAGGCCTTTGCCCTGTGGATCGAGCAGTGGGGCAAGCTATACGAGGAGGAGTCGCCATCCCGCATGAT
CATCCAATACATCCATGACAACTATTTCCTGGTCAACCTGGTGGACAACGAGTTCCCGCTGGACAGCTGC
CTGTGGCAGGTGGTGGAGGACACGTTTGAGCTGCTCAACAGGCATCCCACGGAGAGAGAGACACAGGCTC
CATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_010840
Insert Size 1965 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_010840.3, NP_034970.2
RefSeq Size 6008 bp
RefSeq ORF 1965 bp
Locus ID 17769
UniProt ID Q9WU20
Cytogenetics 4 78.67 cM
Gene Summary Catalyzes the conversion of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate, a co-substrate for homocysteine remethylation to methionine.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream translational start codon, compared to variant 1. The encoded isoform (b) is shorter at the N-terminus, compared to isoform a.

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.