Riox1 (NM_023633) Mouse Untagged Clone

CAT#: MC219541

2410016O06Rik (untagged) - Mouse RIKEN cDNA 2410016O06 gene (2410016O06Rik), (10ug)

USD 763.00


Availability*
5 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Riox1 (NM_023633) Mouse Untagged Clone
Symbol Riox1
Synonyms 2410016O06Rik; MAPJD; NO66
Vector pCMV6-Entry
Sequence Data
>MC219541 representing NM_023633
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACGAGCTACCGAATGGCAACGGTGCGGCGCTGCTGAAGCGCGGGCGGGGGAGGCGCCGGCGGCACC
CGCAGTCGCAGCCCCGCGGCGCGTCGGTCTTGGCCCTGCCCTTGCGGCCCCGGAAGATCCGAAGGCACCG
GAAAAGTGCGGCGGCGTCCCGCGTGGCCGCGCTGAGAGCTCGCGCGCTCCGGAGCGAGGACTCGGACTCG
AAAGTGGCGGTGGCCTCGGTTCGGGGCAAGCGGAAGAGGCCGGCAGAGCTGCTGGAGGCCTCGCGGTCGG
CGGAGCCGCGGCCGGTGTCAGCGCGCCCGAGGTCGGCTTCGGCGACGCTGCCGAGCCGCGTGGAGGGATG
GGCTGCGCTCTCCCGGAACCTGGGGACGGCCGCTCCGCCGCCGCCGGGCTCGCACGCGGATGAGCCGGGG
CGACCCCGGGCTTCGCCGCTGCAGCAGGTACTGACGGAGCTGAACGGCATCCCCAGCAGCCGGAGGCGCG
CCGCCCGCCTCTTCGAGTGGCTCCTGGCGCCCCTGCCTCCGGACCACTTCTACCGGCGGCTGTGGGAGCG
GGAGGCGGTGCTGGTGCGGCGGCAGGACCGCAGCTACTACGAGGGTCTCTTCTCCACCGCCGACCTGGAC
TCGATGCTGCGCTACGAGGACGTGCAATTCGGGCAGCATCTGGACGCCGCGCGCTACGTCGATGGACGGC
GGGAGACCTTGAACCCGCCGGGCCGCGCGCTTCCCGCCGCCGCGTGGTCCTTGTACCGAGCCGGCTGCTC
CTTGCGCCTCCTGTGCCCGCAAGCCTTCTCGCCCACCGTGTGGCAGTTTCTGGCCGTGCTCCAGGAGCAG
TTTGGCAGCATGGCGGGCTCCAACGTCTACCTCACGCCCCCGGACTCGCAGGGCTTTGCTCCTCACTACG
ATGACATCGAGGCTTTCGTGTTGCAGCTGGAAGGTCGGAAACTCTGGCGCGTCTACCGACCGCGGGACCC
GAGTGAGGAGTTGGCCCTGACATCTAGTCCCAACTTCAGCCAGGAGGACCTTGGTGAGCCTGTGCTGCAA
ACGGTACTGGAACCTGGAGACCTGCTCTATTTTCCTCGGGGCTTCATTCACCAAGCTGAATGTCAGGATG
GAGTCCACTCCCTACACCTCACCTTGTCCACCTACCAGCGCAATACATGGGGTGACTTCCTGGAGGCTGT
ACTGCCTCTGGCAGTGCAAGCGGCCATAGAGGAGAACGTGGAGTTCCGCAGAGGCTTGCCCCGAGACTTC
ATGGATTACATGGGGGCCCAGCATTCCGACTCTAAGGATCCTAGAAGGACAGCTTTCATGGAAAAGGTGC
GGGTCTTGGTTGCTCGCCTGGGACACTTTGCTCCTGTCGATGCTGTGGCTGACCAGAGAGCAAAAGACTT
CATTCACGATTCCCTGCCCCCTGTGTTGACCGATAGGGAACGGGCTCTAAGTGTTCACGGGCTCCCAGTT
CGCTGGGAGGCTGGAGAACCCGTCAATGTGGGGGCCCAGCTGACAACTGAAACCCAAGTCCACATGCTTC
AGGACGGCGTAGCTCGGCTGGTGGGAGAGGGAGGCCGATTGTTCCTGTATCACACGGTGGAAAACTCTCG
AGTTTATCACCTAGAGGAACCCAAGTGCTTAGAAATCCACCCCCAGCAAGCCGACGCCATGGAACTCTTG
CTTCGCTCCTACCCGGAGTTTGTGAGAGTGGGGGACTTGCCATGTGACAGTGTGGAAGACCAGCTCTCCT
TGGCAACCATGTTATATGATAAGGGGCTGCTACTCACCAAGACACCTCTAGTTCCGAGTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_023633
ORF Size 1812 bp
Insert Size 1812
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_023633.3, NP_076122
RefSeq Size 2346
RefSeq ORF 1812
Locus ID 71952
Cytogenetics 12|12 D1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.