A1cf (NM_001081074) Mouse Untagged Clone

CAT#: MC219534

A1cf (untagged) - Mouse APOBEC1 complementation factor (A1cf), (10ug)

USD 763.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name A1cf (NM_001081074) Mouse Untagged Clone
Symbol A1cf
Synonyms 1810073H04Rik; Acf; ACF64; ACF65; ASP; MCM; mer; MerCreMer; Tg(Myh6-cre/Esr1*)1Jmk
Vector pCMV6-Entry
Sequence Data
>MC219534 representing NM_001081074
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAATCAAATCACAAATCCGGGGATGGATTGAGCGGCACCCAGAAGGAAGCGGCACTCCGCGCACTGG
TCCAGCGCACAGGATATAGCTTGGTCCAGGAAAATGGACAAAGGAAGTATGGTGGCCCTCCACCAGGCTG
GGATTCTACACCCCCAGAAAGGGGCTGCGAGATTTTCATTGGGAAACTTCCCCGGGACCTCTTTGAGGAT
GAACTCATACCATTGTGTGAAAAAATTGGTAAAATTTATGAAATGAGATTGATGATGGATTTTAATGGTA
ACAACAGAGGCTATGCATTTGTAACATTCTCAAATAAGCAGGAAGCCAAGAATGCAATCAAGCAACTTAA
TAATTATGAAATTCGGACTGGCCGTCTCTTGGGAGTCTGTGCCAGTGTGGACAATTGCCGATTGTTTGTG
GGAGGAATCCCCAAAACCAAAAAGAGGGAAGAAATCTTATCAGAGATGAAAAAAGTCACAGAAGGAGTTG
TTGATGTCATTGTCTACCCAAGTGCTGCTGATAAAACCAAAAACCGGGGATTTGCCTTTGTGGAATATGA
GAGTCACCGAGCAGCCGCCATGGCTAGGCGGAGGCTGCTGCCAGGAAGAATTCAGTTGTGGGGACATCCT
ATTGCAGTAGACTGGGCAGAACCAGAAGTTGAAGTTGATGAGGACACAATGTCTTCCGTGAAAATCCTGT
ACGTAAGGAACCTTATGCTGTCTACCTCGGAAGAAATGATTGAAAAGGAATTCAACAGTATTAAACCAGG
TGCTGTGGAAAGAGTGAAGAAGATCCGAGACTACGCTTTTGTGCACTTCAGTAACCGAGAAGATGCAGTT
GAAGCCATGAAGGCTTTGAATGGCAAGGTGCTGGATGGTTCCCCAATAGAAGTGACCTTGGCCAAGCCAG
TGGACAAGGACAGTTATGTTAGGTACACCCGGGGCACCGGTGGCAGGAACACCATGCTGCAAGGAGAATA
CACCTACCCTCTGAGCCATGTTTATGACCCTACCACAACCTACCTTGGAGCTCCTGTCTTCTATACCCCC
CAAGCCTATGCAGCCATTCCAAGTCTTCATTTCCCAGCTACTAAAGGACATCTCAGCAACAGGGCTCTCA
TCAGGACCCCTTCTGTCAGAGAAATTTACATGAATGTCCCTGTAGGGGCTGCGGGGGTGAGAGGACTGGG
CGGCCGTGGGTATTTGGCATACACAGGCCTGGGTCGAGGATACCACGTCAAAGGAGACAAGAGAGAAGAC
AAACTCTATGATCTTCTGCCTGGGATGGAGCTCACCCCGATGAATACTGTCTCTTTAAAACCACAAGGAA
TTAAACTTGCTCCTCAGATATTAGAAGAAATCTGTCAGAAAAATAACTGGGGACAGCCAGTGTACCAACT
GCATTCTGCCATTGGACAAGATCAAAGACAGTTATTCCTCTACAAAGTAACTATCCCAGCGCTGGCCAGC
CAGAATCCTGCAATCCACCCTTTCATACCACCAAAGCTAAGCGCCTATGTGGATGAAGCGAAGAGGTATG
CTGCAGAGCACACTCTACAGACACTAGGCATCCCCACAGAAGGAGGGGACGCTGGGACTACAGCACCCAC
GGCCACTTCTGCCACTGTGTTCCCAGGATATGCTGTCCCCAGTGCCACCGCTCCTGTGTCTACAGCCCAG
CTCAAGCAAGCAGTGACACTTGGACAAGACTTAGCAGCATATACAACCTATGAGGTCTACCCTACTTTTG
CACTGACCACCCGAGGCGATGCATATGGAACCTTCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001081074
ORF Size 1788 bp
Insert Size 1788
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001081074.1, NP_001074543
RefSeq Size 3828
RefSeq ORF 1788
Locus ID 69865
Cytogenetics 19|19 C1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.