A730008H23Rik (NM_172505) Mouse Untagged Clone

CAT#: MC219454

A730008H23Rik (untagged) - Mouse RIKEN cDNA A730008H23 gene (A730008H23Rik), (10ug)

USD 752.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name A730008H23Rik (NM_172505) Mouse Untagged Clone
Symbol A730008H23Rik
Synonyms mFleg1
Vector pCMV6-Entry
Sequence Data
>MC219454 representing NM_172505
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGTCTATGGGTCGGCAGGACCGCAGGCTGCAGCAGCAGCTTAATGAAAGCAGGAGCCGCTTCCAGA
CGTTAATGAAGCGGCTGATAGCGAAGTACAACCAGCCCTTTGAGGACGACCCGTTGGTGGAGATGACGAC
GTTGACCTACGAGACGCCCCAAGGGTTGAGAGTTTGGGGAGGAAAGCTGATGAAGAAGGAAGACAAGGAA
TACACTCAGAACGCAGAGAAGAGAGGTGGAAAAGACACAGTCATGACTTGGGTTCCTTCCGTGACCTCAT
CTGTCACACCAGCCTCTGGATGCCAGGATGCTATCTCTGCAAAGAGCTCTGGTGGTCCTGGAGTATCTGC
TTTGTCCTCTAGAGGCCAGGGTCCCTCATACCCTTGCCCAGCTGACATGGCCATTGTGGCTAGAAGTGAT
GGCCTCTCCTTACTTGGGACCAGCAGCAACAGCGTAAGCAGCCAGTCCTTTGAGGTTGATGACCTTTGCA
ATGTGACAATCAGCAATTTGTATGAAGGCATGATGCATTCCATGAGTAGGCTGCTGCGCTCAAAGCTATC
CTGCATCATCTCCACCAAGACCTACATCAACCAGAGCTGGAAGCTCCGGAGGAGACCCTCACGCAAGCAG
GGGCTGCACAAGAACAGGACACACTGCCCCCGGAGCAAGCCCTCCCAGAGGAGTGCCAGGAAGGGGCCTG
CATCCTGCTCAGAGCACGGGAAAGAGGCCGGAATATTAAGAGACTACGGGAATTTACTGCACGTTGCTCC
CCACAAGACAGGCTTAGAACTGAAAAGCGTTTCTCTTGAAGGAAGCAAACGCCAAGTCCATAAATTCAGT
CCAGCTTGGAAGGAGCTCCAGATGATGCCGCAGAAGGACTTGGACTTAAACCGTGAGCGAGAAAATAGGG
GGATGACATTACAGTGGCTAATTTCACCCGTCAAGGTGGTTCCCAGACCAAGGATGCTTCCAAGTCAAGT
AGAGAAGTGGTATAGAGAGATTAAAATCAAATTTGACAAGCTTCATCAGGAATATTGCCTGTCTTCTGGG
AAACAGCCTCGCCTGACTGACCCCACAGAGTCTTGGGCTGTCGATGTGTACAGAAGTGGTTCTAAGAGCC
CAGGCAGCCGTCAGGATGTAGAAACCTGCAGGCCCAGTTCACCTTTCGGCAGAGAAAAGACAGAAAGGCC
AGGTGAAGCTTTAGAAGACCTGAGGGGAAATGGAAAGTCTGTCAAAACAAAGAGCTGTCTTCTAAGGAGC
TGTCCCTCTCCAGAGGGCAGCCCTTCACGGAGCCCCAGCCATTCTCAGCTGAGCTCTGGCCTTCAAGAGC
ACAATTCTGAACCTACTGGTAAGGCAGTGTGGCCCAGTACAGCTATTTCAGCACCATGCATAGGCTCTCC
AGGCTGTGGGAAGGATAACTATGATGAGCTTAAAAAAGAATTCAACAGACTTTATCAGAAGTATTGTCTG
TCACCGCAGCGGGCGAAGGTGACTTCGTGTGGCAGAGTATCGCCAATGAAAGCTGCTGCAGCTCTTCCCT
GTCAATCAGAGCACTTGAAGAGACTAAATCCAGACTCCCCACAACAGAGTTCCCAGAAACGGTCAATCTC
TCCTGGCTGTCACAGAAGAGTCCTGCAGGATTCAACTCCACAGACTGCTAGTACACTTGTGAGAGAGCCT
TGGCTTCCAACAAAGAGGCGCAAGTTGTCATACCCGGTAGCTTGTGCTCACCAGGCCAAATCTCACAATA
CCTCAGGAGCATCAGGCTGGCCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_172505
ORF Size 1776 bp
Insert Size 1776
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_172505.4, NP_766093
RefSeq Size 2214
RefSeq ORF 1776
Locus ID 212427
Cytogenetics -
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.