Ryk (NM_013649) Mouse Untagged Clone

CAT#: MC219398

Ryk (untagged) - Mouse receptor-like tyrosine kinase (Ryk), transcript variant 1, (10ug)

USD 752.00


Availability*
5 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Ryk (NM_013649) Mouse Untagged Clone
Symbol Ryk
Synonyms AW536699; ERK-3; Vik
Vector pCMV6-Entry
Sequence Data
>MC219398 representing NM_013649
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCGCGCGGGCCGGGGCGGCGTCCCGGGGAGCGGCGGCCTGAGGGCCCCGCCGCCGCCGCTGCTGCTGC
TGCTGCTGGCGATGCTGCCCGCCGCCGCCCCGCGGTCCCCGGCCCTGGCCGCCGCTCCTGCGGGACCCAG
CGTGAGCCTCTACCTGAGCGAGGACGAGGTGCGCCGGCTGCTTGGTCTTGATGCAGAGCTTTACTATGTG
AGAAATGACCTCATCAGTCACTACGCTCTGTCCTTTAACCTGCTAGTGCCCAGTGAGACAAACTTCCTGC
ACTTCACTTGGCATGCAAAGTCCAAGGTTGAATATAAGCTGGGATTCCAAGTAGACAACTTTGTGGCTAT
GGGCATGCCCCAGGTCAATATTTCTGCTCAAGGGGAGGTCCCACGCACTTTATCAGTGTTTCGGGTCGAG
CTTTCTTGTACCGGCAAAGTCGACTCTGAAGTCATGATTCTAATGCAGCTCAATCTGACAGTGAATTCCT
CAAAAAATTTTACAGTTTTAAATTTTAAACGAAGGAAAATGTGCTACAAAAAACTTGAAGAAGTAAAAAC
TTCAGCCTTGGACAAAAACACTAGCAGAACTATTTATGACCCTGTCCATGCAGCGCCAACGACTTCCACG
CGTGTGTTTTACATCAGTGTAGGGGTTTGCTGTGCAGTGATATTTCTTGTAGCAATAATATTAGCCGTTT
TGCACCTTCATAGCATGAAAAGGATTGAACTGGATGACAGCATCAGCGCCAGCAGTAGTTCCCAGGGGCT
GTCTCAGCCGTCTACCCAGACGACCCAGTATCTGAGAGCTGACACACCCAACAATGCAACGCCTATCACC
AGCTCCTCAGGTTATCCTACCTTGCGGATAGAGAAGAACGACTTGCGAAGTGTCACTCTTCTGGAAGCCA
AAGCCAAGGTGAAGGATATCGCAATATCCAGAGAAAGGATCACACTGAAAGATGTCCTCCAAGAAGGTAC
TTTTGGGCGTATTTTCCATGGGATTTTAGTAGATGAAAAAGATCCAAATAAAGAGAAGCAAACATTTGTA
AAAACAGTTAAAGACCAAGCATCTGAAGTTCAGGTGACGATGATGCTCACCGAGAGCTGCAAGCTTCGAG
GTCTGCACCACAGAAACCTCCTTCCTATTACTCATGTGTGCATAGAAGAAGGAGAAAAGCCCATGGTGGT
ATTGCCATACATGAATTGGGGGAATCTTAAATTATTTCTTCGGCAGTGCAAATTAGTAGAAGCCAATAAT
CCACAGGCAATTTCCCAGCAAGATCTGGTCCATATGGCTATTCAGATTGCCTGCGGGATGAGCTACCTGG
CGAGGAGAGAAGTGATCCATAGAGACCTGGCTGCTAGGAACTGTGTCATCGACGACACTCTTCAAGTCAA
GATCACAGACAATGCCCTTTCCAGAGACTTGTTTCCTATGGACTACCACTGCCTAGGGGACAACGAGAAC
AGGCCAGTGAGATGGATGGCTCTGGAAAGTCTGGTTAATAATGAGTTCTCTAGTGCTAGTGACGTGTGGG
CCTTTGGAGTGACGCTGTGGGAGCTCATGACTCTGGGCCAGACGCCCTACGTGGACATCGACCCCTTTGA
GATGGCCGCTTACCTGAAAGATGGTTACCGAATAGCCCAGCCAATCAACTGCCCTGATGAACTGTTTGCT
GTGATGGCCTGTTGCTGGGCCTTGGACCCTGAGGAGAGGCCTAAGTTCCAGCAGCTGGTCCAGTGCCTCA
CAGAGTTCCACGCTGCCCTGGGAGCCTACGTCTGA


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII     
Tag Tag Free
ACCN NM_013649
ORF Size 1785 bp
Insert Size 1785
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_013649.3, NP_038677
RefSeq Size 3267
RefSeq ORF 1785
Locus ID 20187
Cytogenetics 9 F1|9 54.72 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.