Cdkl3 (NM_001166656) Mouse Untagged Clone

CAT#: MC219337

Cdkl3 (untagged) - Mouse cyclin-dependent kinase-like 3 (Cdkl3), transcript variant 5, (10ug)

USD 742.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Cdkl3 (NM_001166656) Mouse Untagged Clone
Symbol Cdkl3
Synonyms AI852479; B230379H01Rik
Vector pCMV6-Entry
Sequence Data
>MC219337 representing NM_001166656
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGATGTATGAAACCCTTGGAAAAGTGGGAGAGGGAAGTTATGGAACGGTCATGAAATGCAAACATA
AGGACACTGGGCGAATAGTGGCCATTAAGATTTTCTATGAGAAACCAGAAAAATCTGTCAACAAAATTGC
AACGAGAGAAATAAAGTTTCTAAAGCAATTTCGGCATGAAAACCTGGTCAATTTGATTGAAGTTTTTAGA
CAAAAGAAGAAAATTCATTTGGTATTTGAGTTTATTGACCACACGGTCTTAGATGAGCTGCAGCACTACT
GTCACGGACTAGAGAGTAAGCGGCTGAGAAAGTACCTCTTCCAGATCCTTCGCGCCATTGAGTACCTGCA
TAATAATAATATTATCCATCGAGATATAAAGCCTGAGAATATTTTAGTCTCCCAGTCAGGAATTACGAAG
CTGTGTGATTTTGGGTTTGCGAGGACACTAGCAGCTCCTGGAGACGTTTACACAGACTACGTGGCCACAC
GCTGGTACAGAGCTCCAGAGCTGGTGTTGAAAGACACCTCCTACGGAAAGCCAGTGGACATCTGGGCTTT
GGGCTGTATGATCATTGAAATGGCCACTGGCCATCCCTTCCTTCCTAGCAGTTCCGATTTGGATTTGCTC
CACAAGATTGTTTTAAAAGTAGGCAACCTGACCCCGCACCTGCACAATATCTTTTCCAAGAGTCCCATCT
TTGCTGGGGTGGTTCTTCCTCAAGTTCAACACCCAAAAACCGCAAGAAAGAAATACCCCAAGCTCAATGG
ATTGCTGGCAGATATAGTTCATGCTTGTTTACAAATTGATCCTGCTGAGAGGACATCATCTACTGATCTT
TTGCGTCACGATTACTTTACTAGAGATGGATTTATTGAGAAATTCATACCAGAGCTGAGAGCTAAATTAT
TACAGGAAGCAAAGGTTAATTCATTTATAAAGCCAAAAGAGAATTTTAAAGAAAATGAACCTGTGAGAGA
TGAGAAGAAATCAGTTTTTACCAACACCCTGCTCTATGGAAATCCATCACTTTATGGCAAGGAAGTGGAC
AGAGACAAAAGGGCCAAGGAGCTCAAAGTCAGAGTCATTAAGGCCAAAGGGGGCAAAGGAGATGTCCCAG
ACCAGAAGAAGCCAGAGTATGAAGGCGACCACCGCCAGCAGGGCACAGCTGATGACACACAGCCCTCATC
ACTGGACAAGAAGCCTTCTGTCTTGGAACTGACAAACCCTCTCAATCCCAGTGAGAATTCTGACGGTGTC
AAAGAAGACCCACACGCTGGGGGTTGTATGATAATGCCACCTATCAACCTGACAAGCAGTAATTTGTTGG
CCGCAAATCTCAGTTCAAACCTTTCCCACCCCAATTCACGGTTAACTGAAAGAACAAAAAAGAGACGCAC
TTCTTCACAAACTATTGGACAGACTTTGTCTAATAGCAGACAAGAGGACACAGGTCCCACACAAGTCCAA
ACAGAGAAAGGTGCATTTAATGAGCGAACAGGTCAGAATGACCAAATATCGAGTGGGAACAAAAGAAAGC
TGAATTTTCCCAAATGCGACAGGAAAGAATTCCATTTCCCTGAACTGCCATTCACAGTGCAGGCGAAGGA
GATGAAAGGGATGGAAGTTAAACAGATAAAAGTGCTGAAGAGAGAATCAAAGAAAACAGATTCATCTAAA
ATACCAACTTTACTTAGTATGGACCCAAATCAAGAAAAACAAGAGAGTCTCACTATGTACCTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001166656
ORF Size 1746 bp
Insert Size 1746
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001166656.1, NP_001160128
RefSeq Size 2030
RefSeq ORF 1746
Locus ID 213084
Cytogenetics 11|11 B1.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.