Carm1 (NM_153141) Mouse Untagged Clone

CAT#: MC219264

Carm1 (untagged) - Mouse coactivator-associated arginine methyltransferase 1 (Carm1), transcript variant 2, (10ug)


  "NM_153141" in other vectors (3)

Reconstitution Protocol

USD 600.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Carm1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Carm1
Synonyms Prmt4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC219264 representing NM_153141
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGCGGCGGCAGCGACGGCGGTGGGGCCGGGTGCGGGGAGCGCTGGGGTGGCGGGCCCGGGCGGCG
CGGGGCCCTGCGCTACAGTGTCTGTGTTCCCGGGCGCCCGCCTCCTCACTATCGGCGACGCGAACGGCGA
GATCCAGCGGCACGCGGAGCAGCAGGCGCTGCGCCTTGAGGTGCGCGCCGGACCAGACGCGGCGGGCATC
GCCCTCTACAGCCATGAAGATGTGTGTGTTTTCAAGTGCTCGGTGTCCCGAGAGACAGAGTGCAGTCGTG
TGGGCAGACAGTCCTTCATCATCACCCTGGGCTGCAACAGCGTCCTCATCCAGTTTGCCACACCCCACGA
TTTCTGTTCTTTCTACAACATCCTGAAAACCTGTCGGGGCCACACACTGGAGCGCTCTGTGTTCAGTGAG
CGGACAGAGGAATCCTCAGCTGTGCAGTACTTCCAGTTCTATGGCTACCTATCCCAGCAGCAGAACATGA
TGCAGGACTATGTGCGGACAGGCACCTACCAGCGTGCGATCCTGCAGAACCACACGGACTTCAAGGACAA
GATCGTTCTAGATGTGGGCTGTGGCTCTGGGATCCTGTCATTTTTTGCTGCTCAAGCAGGAGCCAGGAAA
ATTTATGCAGTGGAAGCCAGCACCATGGCTCAGCATGCAGAGGTCCTGGTGAAGAGTAACAATCTGACAG
ACCGCATCGTGGTCATCCCTGGCAAAGTAGAGGAGGTCTCATTGCCTGAGCAAGTGGACATTATCATCTC
AGAGCCCATGGGCTACATGCTCTTCAATGAACGAATGCTCGAGAGCTACCTCCATGCCAAAAAGTACCTG
AAGCCTAGTGGAAACATGTTCCCCACCATTGGTGATGTCCACCTCGCACCCTTCACTGATGAACAGCTCT
ACATGGAGCAGTTCACCAAAGCCAACTTCTGGTACCAGCCATCCTTCCATGGAGTGGACCTGTCGGCCCT
CAGAGGCGCCGCTGTGGATGAGTACTTCCGGCAACCTGTGGTGGACACATTTGACATCCGGATCCTGATG
GCCAAATCTGTCAAGTACACAGTGAACTTCTTAGAAGCCAAAGAAGGCGATTTGCACAGGATAGAAATCC
CATTCAAATTCCACATGCTGCATTCAGGGCTAGTCCATGGCTTGGCCTTCTGGTTCGATGTTGCTTTCAT
TGGCTCCATAATGACCGTGTGGCTATCCACAGCCCCAACAGAGCCCCTGACCCACTGGTACCAGGTCCGG
TGCCTCTTCCAGTCACCGTTGTTTGCCAAGGCCGGGGACACGCTCTCAGGGACATGTCTGCTTATTGCCA
ACAAAAGACAGAGCTATGACATCAGTATTGTGGCACAGGTGGACCAGACAGGCTCCAAGTCCAGTAACCT
GCTGGATCTAAAGAACCCCTTCTTCAGGTACACAGGTACAACCCCATCACCCCCACCTGGCTCACACTAC
ACGTCTCCCTCGGAGAATATGTGGAACACAGGAAGCACCTATAATCTCAGCAGCGGGGTGGCTGTGGCTG
GAATGCCTACTGCCTACGACCTGAGCAGTGTTATTGCCGGCGGCTCCAGTGTGGGTCACAACAACCTGAT
TCCCTTAGGCTCCTCAGGTGCCCAGGGAGGCGGCGGTAGCTCCAGTGCCCACTATGCAGTCAACAACCAG
TTCACCATGGGTGGCCCTGCCATCTCTATGGCCTCGCCCATGTCCATCCCGACCAACACCATGCACTATG
GGAGTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_153141
Insert Size 1758 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_153141.1, NP_694781.1
RefSeq Size 3151 bp
RefSeq ORF 1758 bp
Locus ID 59035
UniProt ID Q9WVG6
Cytogenetics 9 A3
Gene Summary Methylates (mono- and asymmetric dimethylation) the guanidino nitrogens of arginyl residues in several proteins involved in DNA packaging, transcription regulation, pre-mRNA splicing, and mRNA stability. Recruited to promoters upon gene activation together with histone acetyltransferases from EP300/P300 and p160 families, methylates histone H3 at 'Arg-17' (H3R17me), forming mainly asymmetric dimethylarginine (H3R17me2a), leading to activates transcription via chromatin remodeling. During nuclear hormone receptor activation and TCF7L2/TCF4 activation, acts synergically with EP300/P300 and either one of the p160 histone acetyltransferases NCOA1/SRC1, NCOA2/GRIP1 and NCOA3/ACTR or CTNNB1/beta-catenin to activate transcription. During myogenic transcriptional activation, acts together with NCOA3/ACTR as a coactivator for MEF2C. During monocyte inflammatory stimulation, acts together with EP300/P300 as a coactivator for NF-kappa-B. Acts as coactivator for PPARG, promotes adipocyte differentiation and the accumulation of brown fat tissue. Plays a role in the regulation of pre-mRNA alternative splicing by methylation of splicing factors. Also seems to be involved in p53/TP53 transcriptional activation. Methylates EP300/P300, both at 'Arg-2142', which may loosen its interaction with NCOA2/GRIP1, and at 'Arg-580' and 'Arg-604' in the KIX domain, which impairs its interaction with CREB and inhibits CREB-dependent transcriptional activation. Also methylates arginine residues in RNA-binding proteins PABPC1, ELAVL1 and ELAV4, which may affect their mRNA-stabilizing properties and the half-life of their target mRNAs.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an exon in the 3' coding region compared to variant 1. The resulting protein (isoform 2) is shorter but has the same N- and C-termini compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.