Trmt2a (NM_001195205) Mouse Untagged Clone

CAT#: MC219160

Trmt2a (untagged) - Mouse TRM2 tRNA methyltransferase 2 homolog A (S. cerevisiae) (Trmt2a), transcript variant 4, (10ug)

USD 732.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Trmt2a (NM_001195205) Mouse Untagged Clone
Symbol Trmt2a
Synonyms Htf9c
Vector pCMV6-Entry
Sequence Data
>MC219160 representing NM_001195205
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGTGAGCCGGCCGCGGAAGTTCCGGAGCCCATGGAGGACTGCGGCCAGGATGCCAGTGCTGTACCCA
GCTCTGCGGCCCCACTATGTCAAAAAGAGGAAGCAGGGCCTGGGCCAGCTGCAGGGCCTGGAACGCAGCC
TGGGCTCTACAGCTACATAAGGGATGACTTGTTCACATCAGAAATCTTTAAACTGGAGCTCCAAAATGTA
CCTCGCCACGCCAGCTTCAGTGACGTCCGGCGTTTTCTAGGCCGTTTTGGTCTACAGTCCCACAAAATCA
AACTCTTTGGACAGCCACCATGTGCCTTTGTAACATTCCGAAGCGCTGCTGAACGAGACAAGGCCTTGCG
AGTGCTGCACGGTGCTCTCTGGAAAGGCTGTCCGCTCAGCGTACGCCTGGCCCGACCCAAGGCTGACCCC
ATGGCTAGGAAGAGGCGGCAAGAAGGTGATAGTGAGCCATCAGTAACACAAATTGCCGATGTGGTGACCC
CTCTGTGGACAGTGCCCTACACTGAGCAGCTGGAGCAGAAGCGACTGGAATGTGAGCGGGTGCTACAGAA
ACTGGCCAAAGAAATTGGGAACACTAATCGTGCCCTGCTACCCTGGCTGCTTTTACAGAGACAACAGCAC
AATAAAGCTTGTTGCCCCCTGGAGGGGGTCAAGCCATCACCCCAGCAGACTGAATATCGTAATAAATGTG
AATTCCTGGTCGGAGTTGGGGTAGACGGCAAGGACAACACAGTTGGCTGCCGGCTTGGCAAGTACAAGGG
TGGAACATGTGCTGTGGCAGCTCCCTTTGACACTGTGCACATTCCAGAGGCCACTAAGCAGGTGGTGAAG
GCCTTCCAGGAATTCATCCGTTCCACACCATACTCGGCATATGACCCTGAGACATATACAGGCCACTGGA
AGCAACTGACTGTTCGTACCAGCAGCCGAGGCCAGGCCATGGCCATTGCCTACTTCCATCCCCAGAAACT
GAGCTCTGAGGAGGTGGCAGGACTAAAGGCCTCCCTGGTGTGCCACTTCATGGAGGGGCCAGGCAAGGCC
AGTGGGGTGACCTCCCTCTACTTTGTGGAGGAGGGACAGAGAAAGACTCCCAGCCAGGAAGGCCTGCCCC
TGGAGCATATGGCTGGCGACCAGTGCATTCAGGAAGACCTGCTAGGGCTGACCTTCCGCATCTCCCCTCA
TGCATTCTTCCAGGTAAACACACCTGCAGCTGAGGTGCTCTACACAGTAATCCAGGAATGGGCACAGCTA
GATGGGGGCAGTACAGTGCTGGACGTGTGCTGTGGCACTGGCACCATAGGCCTGGCCCTGGCTCCGAAGG
TGAAGAGAGTAGTGGGAATTGAACTGTGCCAGGAGGCTGTGGAGGATGCCCGGATGAACGCCCTCACCAA
TGATTCTAAGGTGATTCTGGCCATCCGGAAAGCTGAGAACATCAAGCGACTCCTGTATGTTTCCTGTAAC
CCCAGGGCAGCCATGGGCAACTTTGTGGACCTCTGCAGGGCCCCATCTAACCGAGTAAAAGGCACCCCAT
TCCATCCAGTCAAGGCTGTGGCAGTGGACCTGTTCCCACAGACTCCGCACTGTGAGATGCTTATCCTGTT
TGAGAGGATGCAACAACACCCCAATGGCATAGAAGCCCTGGAGCATCAAGAATTTCAGACCCCAAGAAAT
CTTCCTGATATCACTCCACAGGAAACAGAGATTTCCCTCTCATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001195205
ORF Size 1725 bp
Insert Size 1725
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001195205.1, NP_001182134
RefSeq Size 3520
RefSeq ORF 1725
Locus ID 15547
Cytogenetics 16 A3|16 11.31 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.