Nepro (NM_145972) Mouse Untagged Clone

CAT#: MC219112

BC027231 (untagged) - Mouse cDNA sequence BC027231 (BC027231), (10ug)

USD 721.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Nepro (NM_145972) Mouse Untagged Clone
Symbol Nepro
Synonyms Nepro
Vector pCMV6-Entry
Sequence Data
>MC219112 representing NM_145972
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCGCTGCGGTGCGGCCGGGTGCGGAGCCGTGGAACCGCGTGAGGATCCCCCAGGCGGGGAACTGCA
GCACGCTGACCGTGCGGGACCCCAGCGCCACCCTGGATATCTGCACTGCAGCTGTCACTAAAGGGTGCCA
CCTTGTCACACAGTCACTCAAGAGCCAGACCTTGGATGCGGAAGTAGATGTGTTATGCTCAGTTCTCTAC
AGCAATCACAACAGGTTGGGCCACCACAAGCCCCATTTGGCCCTCAGACAGGTAGAACAGTGCTTAAAGC
GTTTGAAACATATGAATTTGGAGGGCTCAATTGAAGACCTGTCACAGTTGTTGTCTGCCAATGCAACTCA
GCCTGGAGCTACAGAAAACCGCGTCGTCCCCAGCCAGCCGGTGGTGGAGGTGGTGCTGATGAAGGTTTTG
GGAGGCTGCAAGTTGTTACTGCGCTTGCTGGACTGCTGCTGCAAGGCATTTCTGTTGACTGTGAAGCACT
TAGGGCTAAAGGAATTCATTATTTTGAACCTTGTGATGGTTGGACTGGTGAGCAGGCTATGGGTTCTCCA
TAAAGGACTTTTGAGAAGGCTCATTTCCTTATATGAGCCATTACTCAGCTTGCGTCAGGAGATCTCCAGC
ATTCATCCCATGCCTTACTTCAAAGATTTTGCCTTTCCCTCTGACATCACTGACTTTCTAGGCCCCTCTT
ACCTTGAAGTGTTCAAGGTAAAAACACCTGCGGCTTCTGCTACTAAAGGAGTAACAAAGTTGCTAAATAA
ACTGTTTTTAATGAGAGAGCAGCTACCAAAGATGAATGAAGACACTTTAGATAGACTTTCCAAACCATCT
GAACAAATGACAAGCAATCCACAGAGCACTGTGGACCTGGGCCAGCCAGTGAAAGCCTGTAAGAGGACCA
GAAAAGAAAAGCCATTGGGATTTGACCTTCGGGCTTTTTGCACAAGACTTGGAAACAAAGCGACTCAGGA
GACCAACCGTGACTTTAAATATTCTCAGTCCAAACTGAAGACAACCAAACTTCCCTCTCAGCAACTGAGA
ACTCACTGGGCTAACGATACTGTGCAAAGAATCCGAAAGACCAAGACGTTCGCCCAACTTTCTGAAGAAA
TTGAAATGGCAATTGTGTGGTCCCGGAGCAAAAAGCTCAAGACTCAGGCTACCTTTCTGGGCAACAAACT
TCTTAAGAGTAATAGGTTTAGACATGTGGAATCTCAAGGCTATAGTTTGACAAAGAAGCTCCAGTGCATG
AAAACATCTCTCTGCAACTGCCTTCTCCGAGGCTCTCGTACCAGCACTTCAGAGCATCCTCCCAGACAAA
GAAGATCAAAGTATAAAGTTTTATCAAGACAAAGGAAACCGCAGAGAAAGTTACAGTCAACTCTTTTAAA
GGAAACCCAGCAGGTCCCTGAAGGGACTCTGAAGAACACTAGGGACAGCAGTGCTAAGAGGAGATGCTCT
GGGACAGTTCAGAGGTCAGATGTCTGTCCTAATGGAAAGCAGGTCTTGAGAAAACTTGCAAAGCCTGACC
TAAAAACAAAGGTGGTGGTCCACGGGAATCTTACAGGGGGCAGTAGAAATGAATCTGGCTTTCAGGCGAA
GACACAGATGCACACACACAATGCGCCAGACACTGCTAAAGAGGCAGATGACATTGATGATATTTTTGCT
TTGATGGGAGTTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_145972
ORF Size 1695 bp
Insert Size 1695
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_145972.4, NP_666084
RefSeq Size 2866
RefSeq ORF 1695
Locus ID 212547
Cytogenetics 16|16 B4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.