Tbc1d24 (NM_001163849) Mouse Untagged Clone

CAT#: MC219009

Tbc1d24 (untagged) - Mouse TBC1 domain family, member 24 (Tbc1d24), transcript variant 3, (10ug)

USD 711.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Tbc1d24 (NM_001163849) Mouse Untagged Clone
Symbol Tbc1d24
Synonyms 9630033P11; C530046L02Rik; mKIAA1171
Vector pCMV6-Entry
Sequence Data
>MC219009 representing NM_001163849
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACCCCCCAGGGTACAATTGCTTTGTGGATAAGGACAAGATGGATGCATCCATCCAGGACCTGGGGC
CAAAGGAGCTGAACTGCACGGAGCTACAGGAGCTGAAGCAACTGGCACGGCAGGGTTACTGGGCTCAGAG
CCACACCCTGCGCGGGAAAGTGTACCAGCGCCTGATCCGGGACATCCCCTGCCGCACAGTCACACCTGAT
GCCAGCGTGTACAGTGACATTGTGGGGAAGATTGTGGGCAAGCACAGCAGCAGTAGTCTGCCCTTGCCTG
AGTTTGTAGACAACACTCAGGTGCCCACCTACTGCCTGAACACACGGGGTGAAGGGGCTGTGCGCAAGAT
CCTCCTGTGTATTGCCAACCAGTTCCCTGACATCTCCTTCTGCCCTGCCCTGCCTGCTGTGGTGGCCTTG
CTACTGCACTACAGCATCGATGAAGCTGAGTGTTTCGAAAAAGCCTGCCGCATCTTATCCTGCAATGACC
CCACCAAGAAGCTCATTGACCAGAGCTTCCTGGCCTTTGAGTCTTCCTGTATGACATTTGGGGACCTGGT
GAACAAGTACTGCCAGGCAGCCCATAAACTGATGGTGGCCGTGTCAGAGGACGTCCTGCAGGTCTACTCT
GACTGGCAGCGATGGCTCTTTGGGGAGCTGCCCCTCAATTACTTTGCCCGTGTTTTTGATGTCTTCCTTG
TAGAAGGCTACAAAGTATTGTACCGAGTTGCTCTGGCCATCCTCAAGTTCTTCCACAAGGTGAGAGCAGG
ACAGCCCCTTGAGTCAGACAATGTAAAGCAAGACATCCGAATGTTTGTCAAGGACATTGCCAAGACAGTG
TCCCCTGAGAAACTACTAGAGAAGGCCTTTGCCATCCGCCTATTTTCCCGAAAGGAGATCCAGCTCTTGC
AAATGGCCAATGAGAAAGCACTGAGGCAGAAGGGTATAACTGTCAAACAGAAGAGTGTCTCACTTTCTAA
AAGGCAGTTTGTGCACTTAGCTGTCCATGCAGAGAACTTCCACTCAGAGATTGTCAGCGTGAAGGAGATG
AGAGACATTTGGTCCTGGATCCCTGAGCGCTTTGCCCTCTGCCAACCCCTCCTGCTCTTCTCATCACTGC
AGCATGGGTACAGCCTAAGCAGGTTCTATTTCCAGTGTGAAGGACATGAGCCCACCCTCCTGCTCATCAA
GACCACTCAAAAGGAGGTCTGTGGGGCTTACCTGTCAACAGACTGGAGCGAGAGGACTAAATTCGGAGGC
AAGCTGGGCTTCTTTGGGACTGGAGAATGCTTTGTTTTTAGGCTGCAGCCGGAAGTGCAGCGCTATGAGT
GGGTGGTCATCAAACACCCAGAGCTGACCAAGGCAACATCCCTCAAGTCTTCAGAGGCTGCAGGCAGTTC
TTCCCTCATCAGCCACTGCTCTTCAGACCCCGCTGATCGGCTCTCCCCTTTCCTGGCTGCCCGGCACTTC
AACCTGCCCTCCAAGACTGAGTCCATGTTCATGGCTGGAGGCAATGACTGCCTCATCATTGGGGGAGGAG
GTGGTCAAGCACTCTACGTTGATGGGGACCTGAATCGAGGGCGCACTGGACACTGTGACACATTCAACAA
CCAGCCCCTCTGCTCTGAGAACTTCCTCATCGCAGCTGTGGAGGCTTGGGGCTTCCAAGACCCTGACACC
GAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001163849
ORF Size 1686 bp
Insert Size 1686
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001163849.1, NP_001157321
RefSeq Size 7180
RefSeq ORF 1686
Locus ID 224617
Cytogenetics 17|17 A3.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.