Lgi2 (NM_144945) Mouse Untagged Clone

CAT#: MC218898

Lgi2 (untagged) - Mouse leucine-rich repeat LGI family, member 2 (Lgi2), (10ug)

USD 701.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Lgi2 (NM_144945) Mouse Untagged Clone
Symbol Lgi2
Synonyms mKIAA1916
Vector pCMV6-Entry
Sequence Data
>MC218898 representing NM_144945
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGCTATGGAGAGGCGGCGGGGCGCTGGGGTTGCTGCTGCTGAGCGCCGCGTGCCTCATCCCGCCGA
GCGCGCAGGTGAGGCGGTTGGCGCGCTGCCCCGCCACTTGCAGCTGTACCAAGGAGTCCATCATCTGCGT
GGGCTCCTCTTGGGTGCCTAGGATCGTGCCTGGCGACATCAGCTCCCTGAGCCTAGTAAATGGAACATTT
CTGGAAATCAAGGACCGAATGTTTTCCCACCTGCCCTCTCTGCAGCTGCTATTGCTGAATTCTAACTCAT
TCACGGTGATCCGGGACGATGCCTTTGCTGGCCTTTTTCATCTTGAATACCTGTTCATTGAAGGGAACAA
AATAGAAACCATTTCAAGAAATGCCTTTCGGGGCCTCCGTGACCTGACTCACCTAGACTTAAGGGGTAAT
AAATTTGAATGTGACTGCAAAGCCAAATGGCTGTATCTATGGCTGAAGATGACAAACTCCACCGTCTCTG
ATGTGCTGTGTATCGGTCCACCAGAATACCAGGAGAAGAAACTCAACGAAGTGACCAGCTTTGACTATGA
GTGTACCACCACAGGTCCCCAGACTGATGAAGCCAAGCAGAGAGGATGGCAGTTGGAACTCTCCCTGGGA
TTTTGTGAACTAATATTTGTTTTTCAACACCCACTCTCAGATTTTGTCGTTCATCAGACTCTGCCGTACC
AGTCGGTGTCAGTAGACACGTTCAACTCCAAGAACGATGTGTACGTGGCCATCGCTCAGCCCAGCATGGA
GAACTGCATGGTGTTGGAGTGGGACCACATAGAAATGAATTTCCGGAGTTATGACAATATCACAGGCCAG
TCCATCGTGGGCTGCAAGGCCATCCTCATTGACGACCAGGTCTTTGTGGTGGTGGCCCAGCTCTTCGGTG
GCTCTCACATTTACAAATACGACGAGAGCTGGACCAAGTTTGTCAAGTTCCAAGACATAGAGGTGTCTCG
GATTTCCAAGCCCAACGACATTGAGCTGTTCGAGATCGACGACGAGACCTTCTTCATCATCGCCGACAGC
TCCAAAGCGGGGCTGTCCACAGTTTACAAGTGGAACAGCAAAGGGTTTTACTCCTACCAGTCACTACATG
AGTGGTTCAGGGACACAGATGCGGAGTTTGTTGACATCGACGGGAAGTCTCACCTCATCCTGTCTAGCCG
CTCCCAGGTCCCCATCATCCTGCAGTGGAATAAAAGTTCCAAGAAGTTTGTCCCCCATGGTGACATCCCC
AATATGGAGGATGTGCTGGCTGTGAAGAGCTTCCGGATGCAGAACACCCTCTACCTTTCCCTCACCCGTT
TCATTGGGGACTCGCGGGTCATGCGTTGGAACAGTAAGCAGTTTGTGGAGGTCCAGGCTCTTCCTTCCCG
GGGGGCTATGACCTTGCAACCCTTCTCCTTCAAAGATAACCACTACCTGGCCCTGGGGAGTGACTACACG
TTCTCACAGATCTACCAGTGGGATAAAGAGAAACAGCAGTTTAAAAAGTTTAAAGAAATCTATGTGCAGG
CGCCTCGGTCCTTCACAGCCGTCTCCACCGACAGGAGAGATTTCTTTTTTGCATCCAGTTTCAAAGGGAA
GACAAAGATTTTTGAACATATCATTGTTGATTTAAGTTTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_144945
ORF Size 1653 bp
Insert Size 1653
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_144945.3, NP_659194
RefSeq Size 6315
RefSeq ORF 1653
Locus ID 246316
Cytogenetics 5|5 C1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.