Mier3 (NM_172593) Mouse Untagged Clone

CAT#: MC218883

Mier3 (untagged) - Mouse mesoderm induction early response 1, family member 3 (Mier3), (10ug)

USD 701.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Mier3 (NM_172593) Mouse Untagged Clone
Symbol Mier3
Synonyms 5730509D14; AU015422; D130064H19Rik
Vector pCMV6-Entry
Sequence Data
>MC218883 representing NM_172593
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGAGGCTTCCTTTGGAAGTTCGAGCCCAGTTGGGTCTTTGTCTTCTGAGGACCATGACTTTGACC
CCACTGCTGAGATGCTAGTTCATGACTATGATGATGAAAGAACTCTAGAGGAAGAAGAGTTGATGGACGA
CGGGAAGAACTTCAGCTCTGAAATTGAAGACTTAGAGAAGGAAGGGAACATGCCGCTAGAAGACCTGTTG
GCGTTCTACGGCTATGAATCTACAATTCCAGCGGTTGCGAATTCCAGTGCAAACAGCTCCCCAAGTGAAC
TTGCAGACGAACTACCAGACATGACTCTAGACAAAGAAGAGATCGCGAAAGACCTGCTGTCCGGCGATGA
CGAGGAAACTCAGTCTTCCGCTGATGATCTGACACCGTCCGTGACTTCTCATGAGACTTCGGAGTTCTTC
CCCCGGCCTTTACGATCAAACACTACATGTGATGGAGACAAGGAGTCCGAGATTGAGGACGTTGAAACGG
ACAGTGGTAACTCACCTGAAGATTTGAGAAGGGAAATAATGATTGGTCTAGAGTATCAGGCAGAAATTCC
CCCTTATCTTGGCGAGTACAATGGTGACGACGAGAAAGCTTATGAAAATGAGGACCAGTTACTGTGGCAT
CCTGGTGTGCTTTTGGAGAGCAAAGTCAAGGAGTACCTTGTTGAGACCTCATTGAGAACTGGAAATGAAA
AAGTCCTAGACAGGATTTCTTCAGGCACACACACCAGGGATAATGAACAGGCATTATACGAACTTCTCAA
GTGTAACCACAATATAAAAGAAGCAATTGAAAGGTACTGCTGTAATGGAAAGGCATCTCAAGAAGGAATG
ACAGCATGGACGGAAGAGGAGTGCCGAAGCTTTGAACATGCACTGATGCTTCATGGAAAAGATTTTCATC
TCATTCAGAAAGATAAGGTGAGGTCTAGAACGGTTGCCGAGTGCGTAGCCTTCTACTACATGTGGAAGAA
ATCAGAACGCTATGATTACTTTGCTCAACAGACAAAATTTGGAAAGAAACGCTATAACCATCACCCTGGT
GTTACGGACTACATGGATCGTCTCGTAGATGAGACAGAGTCTCTGGGTGGTACCGTCAGTTCTTCAGCCT
TAACTTGTAACCGGCCTGAGCCCGTTCCTGATCAGCCGCTGAACATTCTCAGCTCCTTCACTGCCAGTGA
CCTGACAGCTTTAACCAACAGTGTAGCAACTGTCTGCAACCCCACCGCTGTGAATTGTCTGGATGACAGC
TTTCCTCCGCTGGCCAACACGCCTCGTGGACACGTCAATCATGTGCCTGTCGTAACGGAAGAGTTACTCA
CCCTGCCCAGCAATGGTGAAAGTGATTGTTTTAATTTATTTGAGACTGGATTTTATCACTCAGAGTTAAA
CCCCATGTGCAGCGAAGAATCCGAAAGACCAGCAAAGAGATTGAAGATGGGCATTGCTGTCCCCGAATCC
TTTATGAATGAGGTTTCTGTAAACAACCTGGGTGTAGACTTTGAAAACCATACACATCACATCACCAGTG
CCAAAATGGCTGTCTCTGTAGCTGACTTTGGCAGTTTGTCTGCCAACGAGACAAACGGATTCATCAATGC
CCATAGTCTGCATCAGCACCAGCACGCCGCCCTTCATTCAGAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_172593
ORF Size 1656 bp
Insert Size 1656
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_172593.3, NP_766181
RefSeq Size 5277
RefSeq ORF 1656
Locus ID 218613
Cytogenetics 13|13 D2.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.