Sgms1 (NM_001168525) Mouse Untagged Clone

CAT#: MC218750

Sgms1 (untagged) - Mouse sphingomyelin synthase 1 (Sgms1), transcript variant 1, (10ug)


  "NM_001168525" in other vectors (4)

Reconstitution Protocol

USD 503.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit polyclonal Anti-Sgms1 Antibody
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Sgms1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Sgms1
Synonyms 9530058O11Rik; AI841905; C80702; Mob; Sms1; Sor1; Tmem23
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC218750 representing NM_001168525
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTGTCTGCCAGGACCATGAAGGAAGTGGTTTACTGGTCACCCAAGAAGGTGGCAGACTGGCTGCTGG
AGAATGCTATGCCAGAATACTGTGAGCCTCTGGAGCACTTCACAGGCCAGGACTTAATCAACCTAACCCA
AGAGGATTTCAAAAAACCCCCACTGTACCGAGTCTCCTCTGACAATGGGCAGCGACTCTTAGACATGATA
GAGACCCTGAAGATGGAGCACCATATGGAAGCACACAAGAATGGCCACGCCAACGGACACCTCAGCATTG
GCGTTGACATTCCCAACCCCGATGGCAGCTTCAGCATCAAGACTAAACCCAACGGAATGCCAAATGGGTT
TAGGAAAGAGATGATCAAGATCCCCATGCCAGAACCGGAGCGCTCCCAGTATCCCATGGAGTGGGGCAAG
ACTTTCCTGGCCTTTCTTTATGCACTTTCCTGTTTTGTTCTCACTACAGTGATGATCTCGGTCGTCCATG
AACGAGTACCTCCTAAGGAGGTGCAGCCTCCACTACCGGACACGTTTTTTGACCATTTTAACCGGGTGCA
GTGGGCGTTTTCTATTTGCGAAATTAACGGCATGATCCTTGTAGGACTCTGGCTATTTCAGTGGCTGCTC
TTAAAATACAAGTCTATTATTAGCAGAAGATTTTTCTGCATAGTTGGCACGCTGTACCTGTATCGGTGTA
TTACAATGTATGTAACTACACTCCCAGTACCTGGCATGCATTTCAACTGTTCTCCGAAGCTCTTTGGAGA
CTGGGAAGCTCAAGTGCGGAGAATAATGAAGCTCATTGCTGGAGGTGGCTTATCCATCACAGGCTCGCAC
AACATGTGTGGCGACTATCTGTACAGTGGCCACACGGTCATGCTAACGCTCACCTACCTATTTATCAAAG
AGTATTCTCCTCGGCGGCTCTGGTGGTACCACTGGATTTGCTGGCTCCTCAGCGTCGTTGGAATCTTCTG
TATTCTCTTAGCGCATGACCACTACACTGTGGACGTGGTGGTGGCCTACTACATCACCACAAGACTCTTC
TGGTGGTATCACACGATGGCCAATCAGCAAGTGCTTAAGGAAGCCTCCCAGATGAACCTCCTGGCCAGGG
TGTGGTGGTACAGGCCATTTCAGTACTTTGAAAAGAATGTCCAAGGAATTGTACCTCGATCTTACCATTG
GCCCTTCCCCTGGCCGGTAGTCCACCTTAGTAGGCAAGTTAAATATAGCCGGCTGGTAAACGACACATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001168525
Insert Size 1260 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001168525.1, NP_001161997.1
RefSeq Size 4056 bp
RefSeq ORF 1260 bp
Locus ID 208449
UniProt ID Q8VCQ6
Cytogenetics 19 C1
Gene Summary Sphingomyelin synthases synthesize the sphingolipid, sphingomyelin, through transfer of the phosphatidyl head group, phosphatidylcholine, on to the primary hydroxyl of ceramide. The reaction is bidirectional depending on the respective levels of the sphingolipid and ceramide. Golgi apparatus SMS1 directly and specifically recognizes the choline head group on the substrate, requiring two fatty chains on the choline-P donor molecule in order to be recognized efficiently as a substrate. Major form in macrophages. Required for cell growth in certain cell types (By similarity). Suppresses BAX-mediated apoptosis and also prevents cell death in response to stimuli such as hydrogen peroxide, osmotic stress, elevated temperature and exogenously supplied sphingolipids. May protect against cell death by reversing the stress-inducible increase in levels of proapoptotic ceramide.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2 and 3 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.