Agxt2 (NM_001031851) Mouse Untagged Clone

CAT#: MC218663

Agxt2 (untagged) - Mouse alanine-glyoxylate aminotransferase 2 (Agxt2), nuclear gene encoding mitochondrial protein, (10ug)

USD 691.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Agxt2 (NM_001031851) Mouse Untagged Clone
Symbol Agxt2
Synonyms AI303810; AI663818
Vector pCMV6-Entry
Sequence Data
>MC218663 representing NM_001031851
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTCTAGCCTGGAGAAATTTGCAGAAACCCTTTTATCTGGAGACTTCTCTCAGAATACTCCAGATGC
GTCCATCCCTGAGCTTAGGTGCTTCCCGGATAGCTGTGCCCAAGCTCACTCTTCATACAAAGCACAGCAT
GCCACCGTGTGACTTCTCACCTGAGAAATACCAGTCCCTGGCCTACAGCCGTGTGCTGGCGATTCACAAG
CAGCATCTTTCTCCTGTGGATACAGCCTATTTCCGGAAGCCTTTGCTACTCCACCAGGGACACATGGAGT
GGCTCTTTGATTCTGAGGGAAACAGATACCTGGACTTCTTCTCTGGGATTGTCACTGTTAGTGTTGGTCA
CTGCCACCCGAAGGTAAGTGCAGTGGCAAAAAAACAGATAGACCGCCTGTGGCATACAAGTTCTGTCTTC
TTCCACTCTCCGATGCATGAATATGCAGAGAAGCTCTCAGCACTCCTTCCTGAGCCTCTTAAGGTCATTT
TCTTGGTGAACAGTGGATCAGAAGCCAACGACCTGGCCATGGTGATGGCCCGAGCACACTCGAATCACAC
AGACATCATATCTTTCAGAGGAGCCTATCACGGATGCAGTCCCTATACACTTGGCCTGACAAATGTCGGA
ATCTACAAGATGGAAGTCCCTGGTGGGATAGGCTGCCAATCAACAATGTGCCCAGATGTTTTCCGTGGCC
CTTGGGGAGGAATCCATTGTCGAGATTCTCCAGTGCAAACAGTGAGGGACTGCAGCTGTGCTCCAGGTCC
AAATGGGCAGGGAGGAAGGCGAGAATGCCATTCTAACATCAAATGCTGTGACTTGTGTATGTGTGTATGT
TTTGCTACAGACTGCTGCCAAGCTAAAGAACGGTATATCGAACAATTCAAAGACACACTGAACACTTCTG
TGGCCACATCAATTGCTGGATTTTTTGCAGAGCCAATTCAAGGTGTGAATGGTGTTGTCCAGTACCCAAA
GGAGTTTCTGAAGGAAGCCTTTGCGTTGGTCCGAGAGCGGGGAGGTGTGTGCATCGCAGATGAAGTGCAG
ACAGGCTTTGGCAGGCTGGGCTCTCACTTCTGGGGTTTCCAGACACATGATGTACTTCCTGACATTGTCA
CCATGGCTAAAGGGATTGGAAATGGCTTCCCCATGGCTGCAGTTGTGACCACTCCAGAAATTGCGAAGTC
TTTGGCTAAACGTTTGCTTCACTTCAGCACATTTGGAGGAAATCCCCTGGCCTGCGCCATTGGATCTGCT
GTGCTTGAGGTGATTGAAGAAGAAAATCTCCAGAGAAACAGTCAAGAAGTTGGCACCTACATGCTGCTGA
AGTTTGCTAAGCTTCGGGACGAATTTGATATCGTTGGGGATGTCCGAGGCAAAGGCCTTATGGTGGGGAT
AGAGATGGTTCAAGACAAGATAAGCCGACAACCTCTTCCTAAAACAGAAGTCAATCAAATCCATGAGGAC
TGCAAAGACATGGGGCTCCTAGTGGGTAGAGGTGGTAATTTTTCTCAGACTTTTCGAATTGTGCCCCCGA
TGTGTGTCACGAAGATGGAAGTAGATTTTGCATATGAAGTATTTCGAGCTGCCTTAATTCAACACATGGA
GAGAAGAGCTAAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001031851
ORF Size 1626 bp
Insert Size 1626
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001031851.1, NP_001027021
RefSeq Size 1825
RefSeq ORF 1626
Locus ID 268782
Cytogenetics 15|15 A1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.