Ehd2 (BC027084) Mouse Untagged Clone

CAT#: MC218657

Ehd2 (untagged) - Mouse EH-domain containing 2 (cDNA clone MGC:38650 IMAGE:5356224), (10ug)

USD 691.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Ehd2 (BC027084) Mouse Untagged Clone
Symbol Ehd2
Synonyms MGC25606, MGC38650
Vector pCMV6-Entry
Sequence Data
>BC027084
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCATGGCGAGACAGAGGGCACCGTGCCCGGAAATGCTCTCGTTGTGGACCCAGAGAAGCCCTTCCGCA
AACTCAACCCTTTTGGAAACACTTTTCTCAACAGGTTTATGTGCGCCCAACTCCCCAACCAGGTCCTGGA
GAGCATCAGCATCATCGACACGCCTGGCATCCTATCAGGTGCAAAACAGAGAGTGAGCCGTGGCTACGAC
TTCCCAGCTGTCCTGCGCTGGTTTGCTGAACGCGTGGACCTCATCATCTTGCTCTTTGATGCCCACAAGC
TGGAGATTTCCGATGAATTCTCGGAGGCCATCGGTGCCTTGCGTGGCCACGAGGATAAGATCCGCGTGGT
ACTCAACAAGGCAGACATGGTGGAGACACAGCAGCTGATGCGCGTCTACGGGGCGCTCATGTGGGCGCTG
GGCAAGGTGGTGGGCACGCCTGAGGTCCTTCGCGTCTACATTGGCTCCTTCTGGTCCCAGCCGCTCCTTG
TGCCGGACAACCGGCGTCTTTTCGAGCTGGAGGAACAGGACCTCTTCCGTGATATCCAAGGCCTACCGCG
CCATGCGGCGCTGCGCAAGCTCAACGACCTAGTGAAACGGGCGCGGCTGGTGCGGGTACACGCTTACATC
ATCAGCTACCTGAAGAAAGAGATGCCCACGGTGTTCGGGAAGGAAAACAAGAAGAAGCAGCTGATCCTGA
AGCTGCCTGTCATCTTTGCGAAGATCCAGCTGGAGCACCACATCTCCCCTGGAGACTTTCCTGACTGCCA
GAAGATGCAGGAGCTGTTGATGGCACATGACTTCACCAAGTTCCACTCGCTAAAGCCGAAGCTGCTGGAG
GCGCTAGATGACATGCTGGCCCAAGACATTGCCAAGCTTATGCCGCTGCTTCGGCAGGAGGAGCTGGAGA
GTGTCGAGGCTGGAGTGCAGGGCGGTGCGTTTGAGGGCACCCGCATGGGCCCCTTCGTGGAGCGGGGCCC
TGATGAAGCAATAGAGGATGGTGAGGAGGGCTCAGAAGATGATGCCGAATGGGTGGTGACCAAGGACAAG
TCCAAATACGATGAAATCTTCTACAACTTAGCTCCTGCTGATGGCAAGCTGAGTGGCTCTAAGGCCAAAA
CCTGGATGGTGGGCACAAAGCTACCCAACTCTGTGCTGGGGAGAATCTGGAAGCTGAGCGATGTCGACCG
AGACGGCATGCTGGATGATGAGGAGTTTGCCTTGGCCAGCCACCTCATTGAGGCTAAGCTCGAAGGCCAT
GGTCTACCCACCAACCTACCCCGCCGCCTGGTGCCGCCTTCTAAGCGACGACAGAAGGGCTCTGCTGAAT
GA


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATA
TCCTGGATTACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-RsrII     
Tag Tag Free
ACCN BC027084
ORF Size 1332 bp
Insert Size 1332
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC027084,
RefSeq Size 2717
RefSeq ORF 1332
Locus ID 259300
Cytogenetics 7 A2|7 8.65 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.