Trdn (BC034343) Mouse Untagged Clone

CAT#: MC218487

Trdn (untagged) - Mouse triadin (cDNA clone MGC:8119 IMAGE:3589077), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Trdn
• Synonyms: TDN, triadin-1, triadin-2, triadin-3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC034343
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGACTGAGATCACTGCTGAAGGAAATGCATCGACAACCACAACGGTGATAGACAACAAAAATGGATCTA
  TTCCTAAATCCCCTGGAAAGGTGCTGAAGAGGTCTGTCACCGAAGACATTGTGACAACATTCAGCTCCCC
  TGCAGCCTGGCTTCTTGTCATCGCTCTGATTATCACATGGTCAGCTGTTGCTATCGTGATGTTTGATTTA
  GTGGATTATAAAAACTTTTCAGCAAGCTCCATTGCCAAGATTGGCTCAGATCCTCTAAAACTAGTGAATG
  ATGCTGTGGAGGAGACAACAGACTGGATCTACGGCTTCTTCTCTTTGCTATCTGACATCATCTCATCTGA
  AGGTGACGAAGATGATGAGGATGCAGATGAAGACATTGATAAAGGAGAAATAGAAGAACCTCCCTTAAAA
  AGAAAAGAAATACACCAAGAAAAGGCTGAAAAAGAGGAGAAACCTGAGAAGAAAATACAAACTAAAGCTT
  CACACAGAGAAAAGGAGAAAGGAAAAGAAAAATTAAAAGGAGAAAAACCTGAGAAGACAGCAACTCACAA
  AGAGAAACTTGAGAAAAAAGAAAGACCAGAGACGAAGATGATGGCAAAAGAGGACAAGAAAATTAAGACT
  AAGGAAAAGACTGAAGAAAAGGCTAAGAAGGAAATGAAAGTTGGAAAACAGGAGAAAGTGAAACCAACAG
  CTGCAAAGCCAAAGAAACTCCGAAAACACCACCAAAGGCCAGAAAGAAGGATGACAAAGAGATGCCAGCT
  GTGCATGAGCAGAAAGGACAAAGCCCAGTTATGCCACCACCATCATTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: BC034343
• Insert Size: 819 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC034343, AAH34343
• RefSeq Size: 1045 bp
• RefSeq ORF: 818 bp
• Locus ID: 76757
• Cytogenetics: 10 A4
• Gene Summary: Contributes to the regulation of lumenal Ca2+ release via the sarcoplasmic reticulum calcium release channels RYR1 and RYR2, a key step in triggering skeletal and heart muscle contraction. Required for normal organization of the triad junction, where T-tubules and the sarcoplasmic reticulum terminal cisternae are in close contact. Required for normal skeletal muscle strength (PubMed:19843516). Plays a role in excitation-contraction coupling in the heart and in regulating the rate of heart beats.[UniProtKB/Swiss-Prot Function]